WormBase Tree Display for Expr_pattern: Expr5056

Expr5056 Expression_of: Gene: WBGene00015143
    Reflects_endogenous_expression_of: WBGene00015143
  Homol: Homol_homol: B0336:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term (18)
  Type: Reporter_gene: [B0336.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATATCAATGAAAACGGTCAATGG] 3' and primer B 5' [ATTGTCGATGTGGATGCTTTC] 3'.
  Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; anal sphincter; Reproductive System; uterine-seam cell; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; labial sensilla; tail neurons; unidentified cells in tail ;
    Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; anal sphincter; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; labial sensilla; tail neurons; unidentified cells in tail ;
  Picture: WBPicture0000003546
    WBPicture0000003547
    WBPicture0000003548
    WBPicture0000003549
  Remark: Also expressed in (comments from author) : neural in head may be the Labial Sensilla. Strain shows high intensity GFP, therefore anything neural can be hard to see.
    Strain: BC10655
  Reference: WBPaper00006525
  Transgene: WBTransgene00002352