WormBase Tree Display for Expr_pattern: Expr5056
expand all nodes | collapse all nodes | view schema
Expr5056 | Expression_of | Gene | WBGene00015143 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015143 | ||
Homol | Homol_homol | B0336:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [B0336.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATATCAATGAAAACGGTCAATGG] 3' and primer B 5' [ATTGTCGATGTGGATGCTTTC] 3'. | |
Pattern | Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; anal sphincter; Reproductive System; uterine-seam cell; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; labial sensilla; tail neurons; unidentified cells in tail ; | ||
Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; anal sphincter; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; labial sensilla; tail neurons; unidentified cells in tail ; | |||
Picture | WBPicture0000003546 | ||
WBPicture0000003547 | |||
WBPicture0000003548 | |||
WBPicture0000003549 | |||
Remark | Also expressed in (comments from author) : neural in head may be the Labial Sensilla. Strain shows high intensity GFP, therefore anything neural can be hard to see. | ||
Strain: BC10655 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002352 |