WormBase Tree Display for Expr_pattern: Expr5038
expand all nodes | collapse all nodes | view schema
Expr5038 | Expression_of | Gene | WBGene00007135 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00007135 | ||||
Homol | Homol_homol | CHROMOSOME_III:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005107 | ||||
WBbt:0005733 | |||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
WBbt:0005793 | |||||
WBbt:0005799 | |||||
WBbt:0006751 | |||||
Type | Reporter_gene | [B0285.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGACACATTGCAAAAACTTCTTA] 3' and primer B 5' [CGATATTTCGATGGCTGAAAA] 3'. | |||
Pattern | Adult Expression: arcade cells; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; labial sensilla; unidentified cells in head; | ||||
Larval Expression: arcade cells; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; labial sensilla; unidentified cells in head; | |||||
Picture (3) | |||||
Remark | Also expressed in (comments from author) : head neurons are possibly the Labial Sensilla | ||||
Strain: BC15645 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00004044 |