WormBase Tree Display for Expr_pattern: Expr5038
expand all nodes | collapse all nodes | view schema
Expr5038 | Expression_of | Gene | WBGene00007135 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00007135 | ||
Homol | Homol_homol | CHROMOSOME_III:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [B0285.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGACACATTGCAAAAACTTCTTA] 3' and primer B 5' [CGATATTTCGATGGCTGAAAA] 3'. | |
Pattern | Adult Expression: arcade cells; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; labial sensilla; unidentified cells in head; | ||
Larval Expression: arcade cells; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; labial sensilla; unidentified cells in head; | |||
Picture | WBPicture0000003502 | ||
WBPicture0000003503 | |||
WBPicture0000003504 | |||
Remark | Also expressed in (comments from author) : head neurons are possibly the Labial Sensilla | ||
Strain: BC15645 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004044 |