WormBase Tree Display for Sequence: C46F11
expand all nodes | collapse all nodes | view schema
| C46F11 | DNA | C46F11 | 34841 | |||
|---|---|---|---|---|---|---|
| SMap | S_child | Gene_child (11) | ||||
| CDS_child (316) | ||||||
| Transcript (15) | ||||||
| Nongenomic | yk371b5 | 15611 | 22134 | |||
| PCR_product (29) | ||||||
| Allele (644) | ||||||
| Oligo_set | Aff_C46F11.1 | 5250 | 6603 | |||
| Aff_C46F11.2 | 10049 | 10704 | ||||
| Aff_C46F11.3 | 7851 | 6741 | ||||
| Aff_C46F11.4 | 17244 | 15640 | ||||
| Aff_C46F11.5A | 12248 | 10910 | ||||
| Feature_object (389) | ||||||
| Feature_data | C46F11:Polysome | 1 | 34841 | |||
| C46F11:TranscriptionallyActiveRegion | 1 | 34841 | ||||
| C46F11:ChIPSeqTF | 1 | 34841 | ||||
| C46F11:TRF | 1 | 34841 | ||||
| C46F11:Dust | 1 | 34841 | ||||
| C46F11:inverted | 1 | 34841 | ||||
| Homol_data (20) | ||||||
| Structure | From | Source | CHROMOSOME_III | |||
| Overlap_right | T27D1 | 34740 | ||||
| Overlap_left | C32A3 | |||||
| DB_info | Database | EMBL | NDB_AC | Z81449 | ||
| NDB_SV | Z81449.2 | |||||
| DB_remark | [121025] Sequence correction: SNP 0 bases @ 3618 | |||||
| [121025] Sequence correction: SNP 0 bases @ 3670 | ||||||
| Keyword | HTG | |||||
| EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | ||||
| Origin | From_author | Burton J | ||||
| From_laboratory | HX | |||||
| Date_directory | 960829 | |||||
| Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00000001 | |||||
| Visible | Clone | C46F11 | ||||
| Properties | Genomic_canonical | |||||
| Checksum | MD5 | fc8311d370029dc4671d0ea7b433f4b9 | ||||
| Status | Finished | 29 Aug 1996 00:00:00 | ||||
| Submitted | 04 Nov 1996 00:00:00 | |||||
| Annotated | 13 Nov 1996 00:00:00 | |||||
| Map | Sequence-III | Ends | Left | 1567 | ||
| Right | 1590 | |||||
| Interpolated_map_position | III | -4.89187 | ||||
| Assembly_tags | Clone left end | 1 | 4 | C46F11 | ||
| 25542 | 25545 | T27D1 | ||||
| Finished Left | 1 | 1 | ||||
| annotation | 20532 | 20532 | dificult region where cosmid pcrs have failed. Data suggests an A, but background is high so there is some doubt | |||
| 24354 | 24372 | region that follows, represents 7 copies of a 65bp tandem repeat consensus ATTATTTTTATTCGTCTTATAATTTTAGAAAATTTTCAATAAAAATTTAAGACACTAATAAAAT We were unable to join this using just sequence data alone, and suggest this is due to variation in the consensus sequence within different clones. A phenomenon also seen in pcr across the region. Restrition digest data suggests a 3.2 bp band between 2 flanking StuI sites, so the 2 contigs have been joined and the data edited to a consensus over this region. | ||||
| 24738 | 24738 | probablyA part of tandem repeat | ||||
| Finished Right | 25646 | 25646 | ||||
| Method | Genomic_canonical |
