WormBase Tree Display for Sequence: C46F11

C46F11 DNA: C46F11 34841
  SMap: S_child (10)
  Structure: From: Source: CHROMOSOME_III
    Overlap_right: T27D1 34740
    Overlap_left: C32A3
  DB_info: Database: EMBL NDB_AC Z81449
        NDB_SV Z81449.2
    DB_remark: [121025] Sequence correction: SNP 0 bases @ 3618
      [121025] Sequence correction: SNP 0 bases @ 3670
    Keyword: HTG
    EMBL_dump_info: EMBL_dump_method: worm_EMBL-dump
  Origin: From_author: Burton J
    From_laboratory: HX
    Date_directory: 960829
    Species: Caenorhabditis elegans
    Strain: WBStrain00000001
  Visible: Clone: C46F11
  Properties: Genomic_canonical
    Checksum: MD5: fc8311d370029dc4671d0ea7b433f4b9
    Status: Finished: 29 Aug 1996 00:00:00
      Submitted: 04 Nov 1996 00:00:00
      Annotated: 13 Nov 1996 00:00:00
  Map: Sequence-III Ends: Left: 1567
        Right: 1590
  Interpolated_map_position: III -4.89187
  Assembly_tags: Clone left end 1 4 C46F11
      25542 25545 T27D1
    Finished Left 1 1
    annotation 20532 20532 dificult region where cosmid pcrs have failed. Data suggests an A, but background is high so there is some doubt
      24354 24372 region that follows, represents 7 copies of a 65bp tandem repeat consensus ATTATTTTTATTCGTCTTATAATTTTAGAAAATTTTCAATAAAAATTTAAGACACTAATAAAAT We were unable to join this using just sequence data alone, and suggest this is due to variation in the consensus sequence within different clones. A phenomenon also seen in pcr across the region. Restrition digest data suggests a 3.2 bp band between 2 flanking StuI sites, so the 2 contigs have been joined and the data edited to a consensus over this region.
      24738 24738 probablyA part of tandem repeat
    Finished Right 25646 25646
  Method: Genomic_canonical