WormBase Tree Display for Variation: WBVar02148331
expand all nodes | collapse all nodes | view schema
WBVar02148331 | Name | Public_name | tm10590 | |||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_III | ||||
Flanking_sequences | cttgtagtttttgaattctgtggcatttat | cttcgttttcagactgcatattgatagatt | ||||||
Mapping_target | CHROMOSOME_III | |||||||
Source_location | 7 | CHROMOSOME_III | 679380 | 699722 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm10590_external | |||||||
tm10590_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 10590 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00016029 | ||||||
WBGene00020927 | ||||||||
WBGene00219828 | ||||||||
WBGene00020924 | ||||||||
WBGene00001709 | ||||||||
WBGene00016030 | ||||||||
Transcript | C24A1.2b.1 | |||||||
W02B3.2.1 | ||||||||
C24A1.3.1 | ||||||||
W02B3.4.1 | ||||||||
C24A1.8 | ||||||||
W02B3.7.1 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National BioResource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | [W02B3]12544/12545-[C24A1]7485/7486 (20341 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target W02B3 updated based on the VEP analysis pipeline to CHROMOSOME_III. | ||||||||
Method | NBP_knockout_allele |