WormBase Tree Display for Variation: WBVar02124216
expand all nodes | collapse all nodes | view schema
WBVar02124216 | Name | Public_name | WBVar02124216 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00855139 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_IV | ||||
Flanking_sequences | AGCTGCCCACGAAAATTTCGGGTTTTCCCC | GATTCATCAAGGTATACGATCCAGTTTATG | ||||||
Mapping_target | CHROMOSOME_IV | |||||||
Source_location | 225 | CHROMOSOME_IV | 13454001 | 13468000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023072 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00206493 | ||||||
WBGene00012640 | ||||||||
WBGene00010713 | ||||||||
WBGene00012639 | ||||||||
WBGene00045062 | ||||||||
Transcript | K09B11.9a.1 | |||||||
Y38H8A.7.1 | ||||||||
Y38H8A.12.1 | ||||||||
Y38H8A.5.1 | ||||||||
Pseudogene | Y38H8A.8 | |||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |