WormBase Tree Display for Variation: WBVar02122959
expand all nodes | collapse all nodes | view schema
WBVar02122959 | Name | Public_name | WBVar02122959 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00853882 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_IV | ||||
Flanking_sequences | AAAAGTTAGCAATACACAAAAGAATTTGCG | AGAAAGGCCTTCTTCCCATGAGACAGGAAT | ||||||
Mapping_target | CHROMOSOME_IV | |||||||
Source_location | 225 | CHROMOSOME_IV | 7548001 | 7565000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023192 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00018638 | ||||||
WBGene00018635 | ||||||||
WBGene00003914 | ||||||||
WBGene00002074 | ||||||||
WBGene00018637 | ||||||||
WBGene00018636 | ||||||||
WBGene00000996 | ||||||||
WBGene00302976 | ||||||||
WBGene00043068 | ||||||||
Transcript (14) | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |