WormBase Tree Display for Variation: WBVar00305411
expand all nodes | collapse all nodes | view schema
WBVar00305411 | Evidence | Paper_evidence | WBPaper00036201 | ||
---|---|---|---|---|---|
Name | Public_name | otn8590 | |||
Other_name | OH7677_68702 | ||||
K01B6.1.3:c.2029-15A>T | |||||
K01B6.1.2:c.2029-15A>T | |||||
K01B6.1.1:c.2029-15A>T | |||||
HGVSg | CHROMOSOME_III:g.9295832A>T | ||||
Sequence_details | SMap | S_parent | Sequence | K01B6 | |
Flanking_sequences | AAATCCTTGAAGGTTAGTAGTAAACTTGTCAGATTTGGTAAAATAATTAT | TTTTCTCATTTCAGACAAGCATTGAAAGACTCACTATATATCTTGGAAGC | |||
Mapping_target | K01B6 | ||||
Type_of_mutation | Substitution | A | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00029537 | ||||
Laboratory | OTN | ||||
Analysis | WGS_Hobert | ||||
Status | Live | Curator_confirmed | WBPerson4025 | ||
Affects | Gene | WBGene00010453 | |||
Transcript | K01B6.1.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | K01B6.1.1:c.2029-15A>T | ||||
Intron_number | 8/9 | ||||
K01B6.1.2 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | K01B6.1.2:c.2029-15A>T | ||||
Intron_number | 9/10 | ||||
K01B6.1.3 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | K01B6.1.3:c.2029-15A>T | ||||
Intron_number | 9/10 | ||||
Genetics | Map | III | |||
Reference | WBPaper00036201 | ||||
Remark | This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf268089 | ||
This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||
Method | WGS_Hobert |