WormBase Tree Display for Variation: WBVar00275548
expand all nodes | collapse all nodes | view schema
| WBVar00275548 | Evidence | Paper_evidence | WBPaper00005198 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| WBPaper00026975 | |||||||||
| Name | Public_name | zu405 | |||||||
| Other_name | C09G9.6.1:c.719C>T | ||||||||
| CE03005:p.Pro240Leu | |||||||||
| HGVSg | CHROMOSOME_IV:g.8889984C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C27B7 | |||||
| Flanking_sequences | ctttagaaatgtttgccaggccatcaactc | agatgagccagcggctaaattgccactagg | |||||||
| Mapping_target | C27B7 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00026975 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00035066 | ||||||||
| WBStrain00035067 | |||||||||
| WBStrain00035068 | |||||||||
| WBStrain00048324 | |||||||||
| WBStrain00052677 | |||||||||
| Laboratory | JJ | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003864 | |||||||
| Transcript | C09G9.6.1 | VEP_consequence | missense_variant | ||||||
| VEP_impact | MODERATE | ||||||||
| SIFT | 0 | deleterious | |||||||
| PolyPhen | 0.996 | probably_damaging | |||||||
| HGVSc | C09G9.6.1:c.719C>T | ||||||||
| HGVSp | CE03005:p.Pro240Leu | ||||||||
| cDNA_position | 829 | ||||||||
| CDS_position | 719 | ||||||||
| Protein_position | 240 | ||||||||
| Exon_number | 6/8 | ||||||||
| Codon_change | cCa/cTa | ||||||||
| Amino_acid_change | P/L | ||||||||
| Interactor | WBInteraction000051359 | ||||||||
| WBInteraction000501903 | |||||||||
| WBInteraction000501904 | |||||||||
| WBInteraction000501905 | |||||||||
| WBInteraction000501906 | |||||||||
| WBInteraction000501907 | |||||||||
| WBInteraction000501908 | |||||||||
| WBInteraction000501909 | |||||||||
| WBInteraction000501910 | |||||||||
| WBInteraction000524794 | |||||||||
| Genetics | Interpolated_map_position | IV | 3.99916 | ||||||
| Mapping_data | In_2_point | 7138 | |||||||
| Description | Phenotype | WBPhenotype:0000052 | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Embryos from zu405 homozygous mothers produce 100% dead embryos at a nonpermissive temperature | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | High | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Semi_dominant | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005930 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000062 | Paper_evidence | WBPaper00048539 | |||||||
| Curator_confirmed | WBPerson6615 | ||||||||
| Remark | oma-1(zu405ts) is a temperature-sensitive lethal allele of oma-1; RNAi against oma-1 suppressed oma-1(zu405ts) lethality; this suppression was partially blocked by mes-2(bn11) | Paper_evidence | WBPaper00048539 | ||||||
| Curator_confirmed | WBPerson6615 | ||||||||
| Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00048539 | ||||||
| Curator_confirmed | WBPerson6615 | ||||||||
| WBPhenotype:0000104 | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | In oma-1(zu405) mutant embryos, 30% of the embryos had symmetric levels of POP-1 protein in the daughters of EMS unlike wild-type (low POP-1 in E) | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | Incomplete | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Semi_dominant | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0004804 | PATO:0000460 | Paper_evidence | WBPaper00005930 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Staining with a monoclonal POP-1 antibody (mabRL1) | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000119 | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | OMA-1 protein levels were elevated in embryos past the 1-cell stage compared with wild type embryos | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | High | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Semi_dominant | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005930 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | OMA-1 antibody staining | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000414 | Paper_evidence | WBPaper00005930 | |||||||
| WBPaper00046178 | |||||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPerson13958 | |||||||||
| Remark | The C blastomere in the oma-1(zu405) mutant expresses high levels of EMS transcription factors MED-1 and SKN-1 | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| cell fate transformation: MSa-to-MS transformation (Figure 4) | Paper_evidence | WBPaper00046178 | |||||||
| Curator_confirmed | WBPerson13958 | ||||||||
| Penetrance | Incomplete | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| High | Paper_evidence | WBPaper00046178 | |||||||
| Curator_confirmed | WBPerson13958 | ||||||||
| Semi_dominant | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0003810 | PATO:0000460 | Paper_evidence | WBPaper00005930 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBbt:0006086 | PATO:0000460 | Paper_evidence | WBPaper00046178 | ||||||
| Curator_confirmed | WBPerson13958 | ||||||||
| Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Mutant embryos were stained with SKN-1 antibodies | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Genotype | med-1p::gfp | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000824 | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | After laser ablation of blastomeres in oma-1(zu405) embryos, an isolated P2 blastomere produces pharyngeal muscles, body wall muscles, and intestinal cells, tissue types similar to those normally produced by a wild-type EMS blastomere | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | High | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Semi_dominant | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006873 | PATO:0000460 | Paper_evidence | WBPaper00005930 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | The fate of P2 blastomeres was assayed by killing all other blastomeres via laser and allowing the partial embryo to develop in isolation | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000832 | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | In contrast to wild-type C blastomeres (which produce skin and muscle) over half of C blastomeres from oma-1(zu405) embryos produced either pharyngeal cells or pharyngeal and intestinal cells | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | Incomplete | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Semi_dominant | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0003810 | PATO:0000460 | Paper_evidence | WBPaper00005930 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | The fate of C blastomeres was assayed by killing all other blastomeres via laser and allowing the partial embryo to develop in isolation | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000834 | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | After laser ablation of blastomeres in some oma-1(zu405) embryos, an isolated EMS blastomere produces pharyngeal muscles, body wall muscles, but no intestinal cells | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | Incomplete | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Semi_dominant | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0004804 | PATO:0000460 | Paper_evidence | WBPaper00005930 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | The fate of EMS blastomeres was assayed by killing all other blastomeres via laser and allowing the partial embryo to develop in isolation | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001235 | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | 50% of oma-1(zu405) embryos had a cleavage axis rotated at least 60 relative to the a-p axis. | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | Incomplete | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Semi_dominant | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006876 | PATO:0000460 | Paper_evidence | WBPaper00005930 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001351 | Paper_evidence | WBPaper00026975 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Importantly, the proline to leucine change (P240L) found in the oma-1 gain-of-function mutants (zu405 and ne411) also prevented phosphorylation at T239 (Figure 5B)." | Paper_evidence | WBPaper00026975 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001635 | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | oma-1(zu405) mutant embryos have excess pharyngeal tissues | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | High | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Semi_dominant | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005930 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Staining with pharynx-specific antibody Mab3NB12 | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001636 | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | oma-1(zu405) mutant embryos have excess intestinal tissues | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | High | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Semi_dominant | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005930 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Staining with intestine-specific antibody MabICB4 | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001645 | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Regulated degradation of PIE-1, POS-1, MEX-1, MEX-5 and MEX-3 maternal proteins is defective in oma-1(zu405) mutant embryos | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Semi_dominant | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005930 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Staining with POS-1, MEX-1, MEX-5 and MEX-3 antibodies | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Genotype | pie-1p::GFP | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00036019 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | No ectopic expression of fkh-6::GFP was observed. | Paper_evidence | WBPaper00036019 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00036019 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000436 | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Spatial localization of OMA-1 resembles wild-type. OMA-1 protein colocalizes with P-granules in the germline precursors in zu405 mutant embryos | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Semi_dominant | Paper_evidence | WBPaper00005930 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005930 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005930 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Costaining with various antibodies known to recognize P-granules, such as OIC4, MEX-1 antibody, and POS-1 antibody | Paper_evidence | WBPaper00005930 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001021 | Paper_evidence | WBPaper00036019 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Mutant males are not feminized based on fkh-6::GFP expression. | Paper_evidence | WBPaper00036019 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00036019 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001357 | Paper_evidence | WBPaper00036019 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | No defects in male gonad morphology was observed. | Paper_evidence | WBPaper00036019 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00036019 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00036019 | ||||||||
| WBPaper00018617 | |||||||||
| WBPaper00026975 | |||||||||
| WBPaper00010630 | |||||||||
| WBPaper00005930 | |||||||||
| WBPaper00027952 | |||||||||
| WBPaper00018887 | |||||||||
| WBPaper00026378 | |||||||||
| WBPaper00046178 | |||||||||
| WBPaper00048539 | |||||||||
| WBPaper00061828 | |||||||||
| Method | Substitution_allele |
