WormBase Tree Display for Variation: WBVar00275487
expand all nodes | collapse all nodes | view schema
WBVar00275487 | Evidence | Paper_evidence | WBPaper00005082 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | zu123 | |||||||
Other_name | CE16526:p.Met1? | ||||||||
VF36H2L.1.1:c.3G>T | |||||||||
HGVSg | CHROMOSOME_I:g.9233555C>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | VF36H2L | |||||
Flanking_sequences | atatttcgattaaataaattttcagatcat | ggttacctattaacaattgcttgttatatt | |||||||
Mapping_target | VF36H2L | ||||||||
Type_of_mutation | Substitution | g | h | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | JJ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000147 | |||||||
Transcript | VF36H2L.1.1 (12) | ||||||||
Interactor | WBInteraction000501765 | ||||||||
WBInteraction000501766 | |||||||||
WBInteraction000521901 | |||||||||
WBInteraction000521904 | |||||||||
WBInteraction000521905 | |||||||||
WBInteraction000541719 | |||||||||
WBInteraction000541720 | |||||||||
WBInteraction000541721 | |||||||||
Genetics | Interpolated_map_position | I | 3.68227 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence (2) | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | severe allele of aph-1 that causes fully penetrant embryonic lethality | Paper_evidence | WBPaper00040544 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence (2) | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Range | 100 | 100 | Paper_evidence | WBPaper00005082 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00005082 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005082 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | |||||||||
WBPhenotype:0000052 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Maternal effect lethal. Maternal rescue complete. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | Strictly_maternal | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000080 | Paper_evidence (2) | ||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | Mutants have a partial pharynx as evident from their morphology as well as antibody staining to pharyngeal cells | Paper_evidence | WBPaper00005082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
no anterior pharynx | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
embryos lack an anterior pharynx (due to failed Notch signaling at the 12-cell stage) | Paper_evidence | WBPaper00040544 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00040544 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00005082 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations (2) | |||||||||
Maternal | Strictly_maternal | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | antibody staining with mAb 3NB12 (stains pharyngeal cells) | Paper_evidence | WBPaper00005082 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000749 | Paper_evidence | WBPaper00040544 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Embryos fail to complete body morphogenesis because of failed Notch signaling at the 4- cell stage | Paper_evidence | WBPaper00040544 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00040544 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000008 | PATO:0000460 | Paper_evidence | WBPaper00040544 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000867 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | resembles Glp-1 embryonic phenotype | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | Strictly_maternal | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001403 | Paper_evidence | WBPaper00005082 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mislocalization of APH-2 protein. In aph-1 mutant embryos, APH-2 was not detectable on the cell surface, and was instead prominent in the cytoplasm | Paper_evidence | WBPaper00005082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00005082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 100 | 100 | Paper_evidence | WBPaper00005082 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00005082 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000008 | PATO:0000460 | Paper_evidence | WBPaper00005082 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000071 | PATO:0000460 | Paper_evidence | WBPaper00005082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000072 | PATO:0000460 | Paper_evidence | WBPaper00005082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000009 | PATO:0000460 | Paper_evidence | WBPaper00005082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | |||||||||
Phenotype_assay | Treatment | antibody staining with anti-APH-2 | Paper_evidence | WBPaper00005082 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001566 | Paper_evidence | WBPaper00005082 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Hypodermis fails to enclose the embryo, and instead clumps together on the dorsal side of the embryo | Paper_evidence | WBPaper00005082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00005082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 100 | 100 | Paper_evidence | WBPaper00005082 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00005082 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005082 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | |||||||||
Phenotype_not_observed | WBPhenotype:0000093 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | no Lag phenotypes | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | Strictly_maternal | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000823 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | no germ line phenotypes | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | Strictly_maternal | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040544 | ||||||||
WBPaper00005082 | |||||||||
Method | Substitution_allele |