WormBase Tree Display for Variation: WBVar00275456
expand all nodes | collapse all nodes | view schema
WBVar00275456 | Evidence | Paper_evidence | WBPaper00005036 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | zc14 | ||||||
Other_name | CE45635:p.Gly381Arg | |||||||
CE35836:p.Gly723Arg | ||||||||
C41C4.4a.1:c.2167G>A | ||||||||
C41C4.4b.1:c.1141G>A | ||||||||
HGVSg | CHROMOSOME_II:g.8113556C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C41C4 | ||||
Flanking_sequences | tatgtgttaacctcgggtactcatcctttt | gaaaatcattgcacagacaagcaaatattg | ||||||
Mapping_target | C41C4 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005036 | |||
Author_evidence | Andrew Murley | |||||||
Laboratory_evidence | AGD | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00034062 | |||||||
Laboratory | SJ | |||||||
Status | Live | |||||||
Affects (3) | ||||||||
Genetics | Interpolated_map_position | II | 0.679673 | |||||
Description | Phenotype | WBPhenotype:0000081 | Paper_evidence | WBPaper00049705 | ||||
Curator_confirmed | WBPerson34124 | |||||||
Remark | reduced recovery after prolonged L1 arrest | Paper_evidence | WBPaper00049705 | |||||
Curator_confirmed | WBPerson34124 | |||||||
WBPhenotype:0000137 | Paper_evidence | WBPaper00040397 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The ire-1(zc14) mutation suppressed the tunicamycin-induced increase in mRNA expression of uggt-1 and hsp-4 | Paper_evidence | WBPaper00040397 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00005432 | ||||||
WBPaper00030999 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson2987 | ||||||||
Remark | hsp-4::GFP was not induced in untreated or Cd++ treated animals. | Paper_evidence | WBPaper00005432 | |||||
Curator_confirmed | WBPerson712 | |||||||
ire-1(zc14) suppressed the expression of hsp-4::GFP induced by cdc-48.1(RNAi);cdc-48.2(RNAi) | Paper_evidence | WBPaper00030999 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
ire-1(zc14) suppressed the expression of hsp-4::GFP induced by hrd-1(RNAi) (Figure 4A) | Paper_evidence | WBPaper00030999 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
ire-1(zc14) suppressed the expression of hsp-4::GFP induced by ufd-1(RNAi) (Figure 4A) | Paper_evidence | WBPaper00030999 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | hsp-4::gfp; cdc-48.1(RNAi); cdc-48.2(RNAi) | Paper_evidence | WBPaper00030999 | ||||
Curator_confirmed | WBPerson2987 | |||||||
hsp-4::gfp; hrd-1(RNAi) | Paper_evidence | WBPaper00030999 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
hsp-4::gfp; ufd-1(RNAi) | Paper_evidence | WBPaper00030999 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001719 | Paper_evidence | WBPaper00032521 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Induction of Phsp-4::GFP expression by either hypoxia or tunicamycin was blocked virtually completely by a loss-of-function mutation in ire-1 [ire-1(lf)]. | Paper_evidence | WBPaper00032521 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00032521 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00032521 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001834 | Paper_evidence | WBPaper00037064 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "All three ire-1 alleles failed to produce detectable levels of spliced XBP-1 under normal conditions or after an HP incubation (Fig. 6D and E)." | Paper_evidence | WBPaper00037064 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001838 | Paper_evidence | WBPaper00032521 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Induction of Phsp-4::GFP expression by either hypoxia or tunicamycin was blocked virtually completely by a loss-of-function mutation in ire-1 [ire-1(lf)]. | Paper_evidence | WBPaper00032521 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00032521 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00032521 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001990 | Paper_evidence | WBPaper00032521 | ||||||
WBPaper00037064 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson2987 | ||||||||
Remark | Animals were weakly resistant. | Paper_evidence | WBPaper00032521 | |||||
Curator_confirmed | WBPerson712 | |||||||
"As previously reported (1), the missense allele ire-1(zc14) was significantly hypoxia resistant (Fig. 5A)." | Paper_evidence | WBPaper00037064 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Recessive | Paper_evidence | WBPaper00032521 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00037064 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002422 | Paper_evidence | WBPaper00037064 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Indeed, in an assay of Tm-induced developmental arrest, both zc14 and tm400 homozygotes and v33 heterozygotes were Tm resistant, whereas v33 homozygotes were Tm hypersensitive, as had been reported previously (Fig. 5C) (48). | Paper_evidence | WBPaper00037064 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002423 | Paper_evidence | WBPaper00037064 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Tunicamycin (Tm) preconditioning in wild type worms leads to increased tolerance to hypoxia. "... three loss-of-function mutant alleles of ire-1 (Fig. 3B), two alleles of atf-6 (Fig. 3D), and an allele of xbp-1 (Fig. 3F) all were defective for Tm preconditioning (Fig. 2D)." | Paper_evidence | WBPaper00037064 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00037064 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00037064 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0001653 | Paper_evidence | WBPaper00005432 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutant animals tolerated cadmium exposure for extended periods of time. | Paper_evidence | WBPaper00005432 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002423 | Paper_evidence | WBPaper00037064 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "HP (hypoxic preconditioning) consistently provided protection from subsequent harsh hypoxic exposure for wild-type animals (Fig. 4A and B)... unlike the case for Tm preconditioning, ire-1(zc14), a missense mutation in the kinase domain that is thought to abolish the XBP-1 endonuclease activity of IRE-1 and behaves as a reduction-of-function allele (Fig. 3B) (8), did not block HP (Fig. 4C)." | Paper_evidence | WBPaper00037064 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00037064 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference (9) | ||||||||
Remark | Updated the mutation to G->A rather than the originally reported G->C based on new sequencing data. | Curator_confirmed | WBPerson1983 | |||||
Method | Substitution_allele |