WormBase Tree Display for Variation: WBVar00266521
expand all nodes | collapse all nodes | view schema
WBVar00266521 | Evidence | Paper_evidence | WBPaper00003414 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | u63 | |||||||
Other_name | CE24843:p.Glu415Lys | ||||||||
C44B11.3.1:c.1243G>A | |||||||||
HGVSg | CHROMOSOME_III:g.3131843C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C44B11 | |||||
Flanking_sequences | gtccactggtatgttggtgaaggaatggag | aaggagaatttagtgaggctcgtgaagatt | |||||||
Mapping_target | C44B11 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003414 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | TU | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003175 | |||||||
Transcript | C44B11.3.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
PolyPhen | 0.851 | possibly_damaging | |||||||
HGVSc | C44B11.3.1:c.1243G>A | ||||||||
HGVSp | CE24843:p.Glu415Lys | ||||||||
cDNA_position | 1343 | ||||||||
CDS_position | 1243 | ||||||||
Protein_position | 415 | ||||||||
Exon_number | 6/7 | ||||||||
Codon_change | Gaa/Aaa | ||||||||
Amino_acid_change | E/K | ||||||||
Interactor | WBInteraction000502025 | ||||||||
WBInteraction000504762 | |||||||||
WBInteraction000504764 | |||||||||
Genetics | Interpolated_map_position | III | -7.53489 | ||||||
Description | Phenotype | WBPhenotype:0000315 | Paper_evidence | WBPaper00001125 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000962 | Paper_evidence | WBPaper00038206 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited reduced fluorescence in GFP-expressing touch receptor neurons (TRNs). | Paper_evidence | WBPaper00038206 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | uIs22(Pmec-3::GFP) | Paper_evidence | WBPaper00038206 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002364 | Paper_evidence | WBPaper00044649 | |||||||
Curator_confirmed | WBPerson9270 | ||||||||
Remark | Spontaneous axon degeneration affecting PLM, PVM, ALM, and AVM. (Figure 5C, S3G) | Paper_evidence | WBPaper00044649 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00044649 | ||||
Curator_confirmed | WBPerson9270 | ||||||||
WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00044649 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00044649 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00044649 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
Phenotype_not_observed | WBPhenotype:0001676 | Paper_evidence | WBPaper00001125 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Touch cell processes have normal numbers of large diameter microtubules compared to processes in control animals. | Paper_evidence | WBPaper00001125 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00038206 | ||||||||
WBPaper00001125 | |||||||||
WBPaper00003414 | |||||||||
WBPaper00044649 | |||||||||
Method | Substitution_allele |