WormBase Tree Display for Variation: WBVar00249771
expand all nodes | collapse all nodes | view schema
WBVar00249771 | Name | Public_name | tm742 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F49E8.3a.2:c.-1-921_144delinsAA | |||||||
F49E8.3b.1:c.192-921_336delinsAA | ||||||||
F49E8.3a.3:c.-1-921_144delinsAA | ||||||||
HGVSg | CHROMOSOME_IV:g.7546864_7548038delinsTT | |||||||
Sequence_details | SMap | S_parent | Sequence | F49E8 | ||||
Flanking_sequences | atgcaccttcaagacatcagtagcttcttt | aatcccatattcagtgaacgggtcgcgtta | ||||||
Mapping_target | F49E8 | |||||||
Source_location | 7 | CHROMOSOME_IV | 7546863 | 7548039 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | TT | ||||||
Deletion | ||||||||
PCR_product | tm742_external | |||||||
tm742_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 742 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003914 | ||||||
WBGene00000392 | ||||||||
Transcript | F49E8.3a.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F49E8.3a.3:c.-1-921_144delinsAA | |||||||
cDNA_position | ?-292 | |||||||
CDS_position | ?-144 | |||||||
Protein_position | ?-48 | |||||||
Intron_number | 1-3/8 | |||||||
Exon_number | 2-4/9 | |||||||
F49E8.4.1 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 1-2/3 | |||||||
Exon_number | 1-4/4 | |||||||
F49E8.3a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F49E8.3a.2:c.-1-921_144delinsAA | |||||||
cDNA_position | ?-344 | |||||||
CDS_position | ?-144 | |||||||
Protein_position | ?-48 | |||||||
Intron_number | 2-4/9 | |||||||
Exon_number | 3-5/10 | |||||||
F49E8.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-145 | |||||||
CDS_position | ?-144 | |||||||
Protein_position | ?-48 | |||||||
Intron_number | 2/7 | |||||||
Exon_number | 1-3/8 | |||||||
F49E8.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F49E8.3b.1:c.192-921_336delinsAA | |||||||
cDNA_position | ?-336 | |||||||
CDS_position | ?-336 | |||||||
Protein_position | ?-112 | |||||||
Intron_number | 2-3/7 | |||||||
Exon_number | 3-4/8 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype | WBPhenotype:0000031 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. M. Han: Gro. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | MH | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. M. Han: slightly Ste. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | MH | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Laboratory_evidence | FX | |||||||
Remark | 4019/4020-TT-5194/5195 (1175 bp deletion + 2 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |