WormBase Tree Display for Variation: WBVar00242554
expand all nodes | collapse all nodes | view schema
| WBVar00242554 | Name | Public_name | sa307 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Other_name | F22E12.4c.1:c.199_309+2del | ||||||||
| F22E12.4b.3:c.973_1083+2del | |||||||||
| F22E12.4a.1:c.973_1083+2del | |||||||||
| F22E12.4e.1:c.745_855+2del | |||||||||
| F22E12.4d.1:c.973_1083+2del | |||||||||
| F22E12.4b.1:c.973_1083+2del | |||||||||
| F22E12.4b.2:c.973_1083+2del | |||||||||
| HGVSg | CHROMOSOME_V:g.10473776_10474018del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | Y32F6B | |||||
| Flanking_sequences | aactccgctgacccaaaaattaattacaag | aagttggtggtacagtacccttgatgcagt | |||||||
| Mapping_target | Y32F6B | ||||||||
| Type_of_mutation | Deletion | ||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004676 | ||||||||
| WBStrain00004678 | |||||||||
| WBStrain00022795 | |||||||||
| WBStrain00040834 | |||||||||
| WBStrain00040846 | |||||||||
| Laboratory | JT | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001178 | |||||||
| Transcript | F22E12.4b.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F22E12.4b.3:c.973_1083+2del | ||||||||
| cDNA_position | 973-? | ||||||||
| CDS_position | 973-? | ||||||||
| Protein_position | 325-? | ||||||||
| Intron_number | 5-6/10 | ||||||||
| Exon_number | 5-6/11 | ||||||||
| F22E12.4b.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F22E12.4b.2:c.973_1083+2del | ||||||||
| cDNA_position | 979-? | ||||||||
| CDS_position | 973-? | ||||||||
| Protein_position | 325-? | ||||||||
| Intron_number | 6-7/8 | ||||||||
| Exon_number | 6-7/9 | ||||||||
| F22E12.4a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F22E12.4a.1:c.973_1083+2del | ||||||||
| cDNA_position | 981-? | ||||||||
| CDS_position | 973-? | ||||||||
| Protein_position | 325-? | ||||||||
| Intron_number | 6-7/11 | ||||||||
| Exon_number | 6-7/12 | ||||||||
| F22E12.4b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F22E12.4b.1:c.973_1083+2del | ||||||||
| cDNA_position | 981-? | ||||||||
| CDS_position | 973-? | ||||||||
| Protein_position | 325-? | ||||||||
| Intron_number | 6-7/10 | ||||||||
| Exon_number | 6-7/11 | ||||||||
| F22E12.4c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F22E12.4c.1:c.199_309+2del | ||||||||
| cDNA_position | 203-? | ||||||||
| CDS_position | 199-? | ||||||||
| Protein_position | 67-? | ||||||||
| Intron_number | 3-4/8 | ||||||||
| Exon_number | 3-4/9 | ||||||||
| F22E12.4e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F22E12.4e.1:c.745_855+2del | ||||||||
| cDNA_position | 745-? | ||||||||
| CDS_position | 745-? | ||||||||
| Protein_position | 249-? | ||||||||
| Intron_number | 3-4/7 | ||||||||
| Exon_number | 3-4/8 | ||||||||
| F22E12.4d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F22E12.4d.1:c.973_1083+2del | ||||||||
| cDNA_position | 981-? | ||||||||
| CDS_position | 973-? | ||||||||
| Protein_position | 325-? | ||||||||
| Intron_number | 6-7/10 | ||||||||
| Exon_number | 6-7/11 | ||||||||
| Interactor | WBInteraction000007904 | ||||||||
| WBInteraction000007906 | |||||||||
| WBInteraction000007908 | |||||||||
| WBInteraction000007910 | |||||||||
| WBInteraction000007911 | |||||||||
| WBInteraction000007912 | |||||||||
| WBInteraction000007913 | |||||||||
| WBInteraction000007914 | |||||||||
| WBInteraction000007916 | |||||||||
| WBInteraction000007918 | |||||||||
| WBInteraction000007920 | |||||||||
| WBInteraction000007922 | |||||||||
| WBInteraction000007924 | |||||||||
| WBInteraction000007926 | |||||||||
| WBInteraction000007928 | |||||||||
| WBInteraction000007929 | |||||||||
| WBInteraction000007930 | |||||||||
| WBInteraction000007934 | |||||||||
| WBInteraction000007939 | |||||||||
| WBInteraction000007941 | |||||||||
| WBInteraction000007942 | |||||||||
| WBInteraction000007945 | |||||||||
| WBInteraction000007946 | |||||||||
| WBInteraction000007948 | |||||||||
| WBInteraction000007949 | |||||||||
| WBInteraction000007951 | |||||||||
| WBInteraction000007954 | |||||||||
| WBInteraction000007957 | |||||||||
| WBInteraction000007958 | |||||||||
| WBInteraction000007959 | |||||||||
| WBInteraction000007960 | |||||||||
| WBInteraction000007961 | |||||||||
| WBInteraction000007963 | |||||||||
| WBInteraction000007966 | |||||||||
| WBInteraction000007970 | |||||||||
| WBInteraction000007971 | |||||||||
| WBInteraction000007973 | |||||||||
| WBInteraction000007975 | |||||||||
| WBInteraction000007976 | |||||||||
| WBInteraction000007977 | |||||||||
| WBInteraction000007978 | |||||||||
| WBInteraction000007979 | |||||||||
| WBInteraction000007980 | |||||||||
| WBInteraction000007982 | |||||||||
| WBInteraction000007984 | |||||||||
| WBInteraction000007986 | |||||||||
| WBInteraction000007988 | |||||||||
| WBInteraction000007990 | |||||||||
| WBInteraction000007992 | |||||||||
| WBInteraction000007993 | |||||||||
| WBInteraction000007994 | |||||||||
| WBInteraction000007995 | |||||||||
| WBInteraction000007996 | |||||||||
| WBInteraction000007999 | |||||||||
| WBInteraction000008000 | |||||||||
| WBInteraction000008001 | |||||||||
| WBInteraction000008003 | |||||||||
| WBInteraction000008005 | |||||||||
| WBInteraction000008007 | |||||||||
| WBInteraction000008009 | |||||||||
| WBInteraction000008011 | |||||||||
| WBInteraction000008013 | |||||||||
| WBInteraction000008015 | |||||||||
| WBInteraction000008017 | |||||||||
| WBInteraction000008019 | |||||||||
| WBInteraction000008021 | |||||||||
| WBInteraction000008023 | |||||||||
| WBInteraction000008025 | |||||||||
| WBInteraction000008027 | |||||||||
| WBInteraction000008029 | |||||||||
| WBInteraction000008031 | |||||||||
| WBInteraction000008034 | |||||||||
| WBInteraction000008037 | |||||||||
| WBInteraction000008038 | |||||||||
| WBInteraction000008040 | |||||||||
| WBInteraction000008043 | |||||||||
| WBInteraction000008044 | |||||||||
| WBInteraction000008045 | |||||||||
| WBInteraction000008048 | |||||||||
| WBInteraction000008050 | |||||||||
| WBInteraction000008051 | |||||||||
| WBInteraction000008054 | |||||||||
| WBInteraction000008059 | |||||||||
| WBInteraction000008065 | |||||||||
| WBInteraction000008066 | |||||||||
| WBInteraction000008067 | |||||||||
| WBInteraction000008069 | |||||||||
| WBInteraction000008070 | |||||||||
| WBInteraction000008072 | |||||||||
| WBInteraction000008073 | |||||||||
| WBInteraction000008074 | |||||||||
| WBInteraction000052952 | |||||||||
| WBInteraction000500251 | |||||||||
| WBInteraction000502640 | |||||||||
| WBInteraction000503646 | |||||||||
| WBInteraction000503647 | |||||||||
| WBInteraction000503648 | |||||||||
| WBInteraction000503649 | |||||||||
| WBInteraction000503650 | |||||||||
| WBInteraction000503651 | |||||||||
| WBInteraction000503652 | |||||||||
| WBInteraction000504805 | |||||||||
| WBInteraction000504806 | |||||||||
| WBInteraction000517465 | |||||||||
| WBInteraction000518662 | |||||||||
| WBInteraction000518663 | |||||||||
| WBInteraction000518665 | |||||||||
| WBInteraction000518666 | |||||||||
| WBInteraction000518667 | |||||||||
| WBInteraction000520581 | |||||||||
| WBInteraction000520582 | |||||||||
| WBInteraction000524655 | |||||||||
| WBInteraction000524657 | |||||||||
| WBInteraction000536403 | |||||||||
| WBInteraction000536404 | |||||||||
| Genetics | Interpolated_map_position | V | 2.56732 | ||||||
| Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00035580 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | " Indeed , egl-9 ( ye49 ) and egl-9 ( sa307 ) mutant animals live longer than N2 wild-type when feeding on the standard E . coli strain ( Figure 4D , Table 2 ) ." | Paper_evidence | WBPaper00035580 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000067 | Paper_evidence | WBPaper00035435 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Animals with the egl-9(sa307) tolerated up to 500 ppm H2S (more robust than WT) | Paper_evidence | WBPaper00035435 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00035435 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000135 | Paper_evidence | WBPaper00035158 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | sa307 mutation in egl-9 resulted in dramatic over-expression of Pnhr-57::GFP and K10H10.2 mRNA | Paper_evidence | WBPaper00035158 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Real time PCR for K10H10.2 mRNA | Paper_evidence | WBPaper00035158 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Genotype | nhr-57p::GFP | Paper_evidence | WBPaper00035158 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000136 | Paper_evidence | WBPaper00040863 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | egl-9(sa307) mutants exhibited an increase in ftn-1 mRNA expression compared to wild type controls (Figure 6B, S3C) | Paper_evidence | WBPaper00040863 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000295 | Paper_evidence | WBPaper00035580 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "We found that , relative to wild-type animals , animals lacking EGL-9 are resistant to killing by 1 ) the pathogen Pseudomonas aeruginosa PA14 ; 2 ) heat stress ; and 3 ) oxidative stress ( Figure 4A , Table 2 ; Figures 4B and 4C) ." | Paper_evidence | WBPaper00035580 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000384 | Paper_evidence | WBPaper00031981 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals showed axon-pathfinding defects along the ventral midline. | Paper_evidence | WBPaper00031981 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Penetrance | Incomplete | Paper_evidence | WBPaper00031981 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006976 | PATO:0000460 | Paper_evidence | WBPaper00031981 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000436 | Paper_evidence | WBPaper00035435 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | HIF-1 protein is detected at high levels in nuclei of egl-9(sa307) mutant animals compared to control | Paper_evidence | WBPaper00035435 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00035435 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000640 | Paper_evidence | WBPaper00003860 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals are visibly Egl. | Paper_evidence | WBPaper00003860 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001013 | Paper_evidence | WBPaper00035580 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "It is interesting to note that egl-9(sa307) mutant animals are hypersensitive compared to wild-type animals to CVD110(VCC-) strain (median survival of 4 and 6 days respectively; P,0.0001; Figure 3A; Table 2)." | Paper_evidence | WBPaper00035580 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001014 | Paper_evidence | WBPaper00003860 | |||||||
| WBPaper00035580 | |||||||||
| WBPaper00037627 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPerson2987 | |||||||||
| WBPerson7196 | |||||||||
| Remark | Animals are resistant to paralysis by infection with P. aeruginosa PAO1. | Paper_evidence | WBPaper00003860 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| "When feeding on CVD109 ( VCC + ) , egl-9 ( sa307 ) animals are resistant relative to wild-type animals ( Figure 3A ; Table 2 ; median survival 4 vs . 3 days respectively ; P , 0.001 ) ." | Paper_evidence | WBPaper00035580 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| "We found that , relative to wild-type animals , animals lacking EGL-9 are resistant to killing by 1 ) the pathogen Pseudomonas aeruginosa PA14 ; 2 ) heat stress ; and 3 ) oxidative stress ( Figure 4A , Table 2 ; Figures 4B and 4C) ." | Paper_evidence | WBPaper00035580 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001236 | Paper_evidence | WBPaper00040863 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | egl-9(sa307) mutants exhibited increased expression of the Pftn-1::GFP transgene, compared to wild type controls (Figure 6A) | Paper_evidence | WBPaper00040863 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | wuIs177 [Pftn-1::GFP] | Paper_evidence | WBPaper00040863 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001276 | Paper_evidence | WBPaper00035435 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | egl-9(sa307); nhr-57::gfp(iaIs07) mutant worms exhibit constitutive expression in both the gut and in the hypodermis unlike control animals | Paper_evidence | WBPaper00035435 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00035435 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001400 | Paper_evidence | WBPaper00039977 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | egl-9(sa307) mutant animals have constitutively high levels of SQRD-1 protein. | Paper_evidence | WBPaper00039977 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Affected_by | Molecule | WBMol:00004296 | Paper_evidence | WBPaper00039977 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001462 | Paper_evidence | WBPaper00036167 | |||||||
| Curator_confirmed | WBPerson1725 | ||||||||
| WBPhenotype:0001645 | Paper_evidence | WBPaper00035158 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | egl-9 allele severely disabled oxygen-dependent degradation of HIF-1 | Paper_evidence | WBPaper00035158 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Western blots | Paper_evidence | WBPaper00035158 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001663 | Paper_evidence | WBPaper00035580 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "We found that , relative to wild-type animals , animals lacking EGL-9 are resistant to killing by 1 ) the pathogen Pseudomonas aeruginosa PA14 ; 2 ) heat stress ; and 3 ) oxidative stress ( Figure 4A , Table 2 ; Figures 4B and 4C) ." | Paper_evidence | WBPaper00035580 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Affected_by | Molecule | WBMol:00001695 | Paper_evidence | WBPaper00035580 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001719 | Paper_evidence | WBPaper00035580 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | " We indeed find that activation of the hypoxia pathway results in activation of the UPR as seen by a 1.4 fold increase in spliced xbp-1 levels in egl-9 mutant animals ( P , 0.001 ; see Materials and Methods ) ." | Paper_evidence | WBPaper00035580 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001765 | Paper_evidence | WBPaper00031935 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals showed attraction to carbon dioxide as opposed to the wild-type response of avoidance. | Paper_evidence | WBPaper00031935 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Strains were maintained at 22C. Animals were exposed to a 5% to 0% CO2 gradient. | Paper_evidence | WBPaper00031935 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0002060 | Paper_evidence | WBPaper00035580 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "L4 staged animals from each genotype and wild-type N2 were placed in numerous doses of Cry21A PFT or Cry5B PFT and scored for viability after a few days (Figures 2B and 2C). As predicted from the above studies , we find that animals lacking EGL-9 are quantitatively resistant to Cry PFTs. At doses from 1-16 μg/mL Cry21A and 10-80 μg/mL Cry5B PFTs , egl-9(sa307) and egl-9(ye49) animals are resistant to PFT-induced mortality relative to wild-type animals , with resistance strongest at higher PFT doses (Figures 2B and 2C ; Table 1)." | Paper_evidence | WBPaper00035580 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002378 | Paper_evidence | WBPaper00058803 | |||||||
| Curator_confirmed | WBPerson36360 | ||||||||
| Phenotype_not_observed | WBPhenotype:0001381 | Paper_evidence | WBPaper00046527 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | egl-9(sa307) mutant worms were not resistant to anoxia exposure when fed a glucose-supplemented diet (Figure S1C) | Paper_evidence | WBPaper00046527 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Affected_by | Molecule | WBMol:00003916 | Paper_evidence | WBPaper00046527 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001990 | Paper_evidence | WBPaper00046162 | |||||||
| Curator_confirmed | WBPerson2857 | ||||||||
| Remark | animals develop the same number of polyglutamine aggregates as wild-type when exposed to environments with either 1000 ppm or 5000 ppm oxygen | Paper_evidence | WBPaper00046162 | ||||||
| Curator_confirmed | WBPerson2857 | ||||||||
| Reference | WBPaper00039977 | ||||||||
| WBPaper00040863 | |||||||||
| WBPaper00031935 | |||||||||
| WBPaper00031981 | |||||||||
| WBPaper00003860 | |||||||||
| WBPaper00035158 | |||||||||
| WBPaper00025692 | |||||||||
| WBPaper00035435 | |||||||||
| WBPaper00036167 | |||||||||
| WBPaper00035580 | |||||||||
| WBPaper00046162 | |||||||||
| WBPaper00046527 | |||||||||
| WBPaper00055561 | |||||||||
| WBPaper00037627 | |||||||||
| WBPaper00058803 | |||||||||
| Method | Deletion_allele |
