WormBase Tree Display for Variation: WBVar00242554
expand all nodes | collapse all nodes | view schema
WBVar00242554 | Name | Public_name | sa307 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F22E12.4c.1:c.199_309+2del | |||||||
F22E12.4b.3:c.973_1083+2del | ||||||||
F22E12.4a.1:c.973_1083+2del | ||||||||
F22E12.4e.1:c.745_855+2del | ||||||||
F22E12.4d.1:c.973_1083+2del | ||||||||
F22E12.4b.1:c.973_1083+2del | ||||||||
F22E12.4b.2:c.973_1083+2del | ||||||||
HGVSg | CHROMOSOME_V:g.10473776_10474018del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y32F6B | ||||
Flanking_sequences | aactccgctgacccaaaaattaattacaag | aagttggtggtacagtacccttgatgcagt | ||||||
Mapping_target | Y32F6B | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004676 | |||||||
WBStrain00004678 | ||||||||
WBStrain00022795 | ||||||||
WBStrain00040834 | ||||||||
WBStrain00040846 | ||||||||
Laboratory | JT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001178 | ||||||
Transcript | F22E12.4b.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F22E12.4b.3:c.973_1083+2del | |||||||
cDNA_position | 973-? | |||||||
CDS_position | 973-? | |||||||
Protein_position | 325-? | |||||||
Intron_number | 5-6/10 | |||||||
Exon_number | 5-6/11 | |||||||
F22E12.4b.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F22E12.4b.2:c.973_1083+2del | |||||||
cDNA_position | 979-? | |||||||
CDS_position | 973-? | |||||||
Protein_position | 325-? | |||||||
Intron_number | 6-7/8 | |||||||
Exon_number | 6-7/9 | |||||||
F22E12.4a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F22E12.4a.1:c.973_1083+2del | |||||||
cDNA_position | 981-? | |||||||
CDS_position | 973-? | |||||||
Protein_position | 325-? | |||||||
Intron_number | 6-7/11 | |||||||
Exon_number | 6-7/12 | |||||||
F22E12.4b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F22E12.4b.1:c.973_1083+2del | |||||||
cDNA_position | 981-? | |||||||
CDS_position | 973-? | |||||||
Protein_position | 325-? | |||||||
Intron_number | 6-7/10 | |||||||
Exon_number | 6-7/11 | |||||||
F22E12.4c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F22E12.4c.1:c.199_309+2del | |||||||
cDNA_position | 203-? | |||||||
CDS_position | 199-? | |||||||
Protein_position | 67-? | |||||||
Intron_number | 3-4/8 | |||||||
Exon_number | 3-4/9 | |||||||
F22E12.4e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F22E12.4e.1:c.745_855+2del | |||||||
cDNA_position | 745-? | |||||||
CDS_position | 745-? | |||||||
Protein_position | 249-? | |||||||
Intron_number | 3-4/7 | |||||||
Exon_number | 3-4/8 | |||||||
F22E12.4d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F22E12.4d.1:c.973_1083+2del | |||||||
cDNA_position | 981-? | |||||||
CDS_position | 973-? | |||||||
Protein_position | 325-? | |||||||
Intron_number | 6-7/10 | |||||||
Exon_number | 6-7/11 | |||||||
Interactor (115) | ||||||||
Genetics | Interpolated_map_position | V | 2.56732 | |||||
Description | Phenotype (20) | |||||||
Phenotype_not_observed | WBPhenotype:0001381 | Paper_evidence | WBPaper00046527 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | egl-9(sa307) mutant worms were not resistant to anoxia exposure when fed a glucose-supplemented diet (Figure S1C) | Paper_evidence | WBPaper00046527 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003916 | Paper_evidence | WBPaper00046527 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001990 | Paper_evidence | WBPaper00046162 | ||||||
Curator_confirmed | WBPerson2857 | |||||||
Remark | animals develop the same number of polyglutamine aggregates as wild-type when exposed to environments with either 1000 ppm or 5000 ppm oxygen | Paper_evidence | WBPaper00046162 | |||||
Curator_confirmed | WBPerson2857 | |||||||
Reference (15) | ||||||||
Method | Deletion_allele |