WormBase Tree Display for Variation: WBVar00145628
expand all nodes | collapse all nodes | view schema
WBVar00145628 | Name | Public_name | gk221 | ||
---|---|---|---|---|---|
HGVSg | CHROMOSOME_V:g.9707259_9709310del | ||||
Sequence_details | SMap | S_parent | Sequence | F40F9 | |
Flanking_sequences | GTAACATTGTGCCAATTTAAATGAATGTGTATTATCGAAAAAATACGATC | AACCAAAAGTTTGCTTAAACACGTGAAAACTCGGAATTTAGGAGAAACTT | |||
Mapping_target | F40F9 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00035757 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
KO_consortium_allele | |||||
Status | Live | Curator_confirmed | WBPerson4025 | ||
Affects | Gene | WBGene00006470 | |||
WBGene00009580 | |||||
Transcript | F40F9.1a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
Intron_number | 7/8 | ||||
Exon_number | 8-9/9 | ||||
F40F9.1a.2 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
Intron_number | 8/9 | ||||
Exon_number | 9-10/10 | ||||
F40F9.1b.3 | VEP_consequence | splice_acceptor_variant,3_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
Intron_number | 8/8 | ||||
Exon_number | 9/9 | ||||
F40F9.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
Intron_number | 2-5/6 | ||||
Exon_number | 3-7/7 | ||||
F40F9.1b.1 | VEP_consequence | splice_acceptor_variant,3_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
Intron_number | 9/9 | ||||
Exon_number | 10/10 | ||||
F40F9.1b.2 | VEP_consequence | 3_prime_UTR_variant | |||
VEP_impact | MODIFIER | ||||
cDNA_position | 1060-? | ||||
Exon_number | 9/9 | ||||
Isolation | Mutagen | TMP/UV | |||
Genetics | Mapping_data | In_multi_point | 5142 | ||
Remark | This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf898404 | ||
This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |