WormBase Tree Display for Variation: WBVar00144308
expand all nodes | collapse all nodes | view schema
WBVar00144308 | Name | Public_name | e1796 | ||
---|---|---|---|---|---|
Other_name | F14F3.1a.2:c.686T>C | ||||
F14F3.1c.1:c.209T>C | |||||
CE28216:p.Ile43Thr | |||||
F14F3.1b.1:c.128T>C | |||||
CE24899:p.Ile229Thr | |||||
CE28217:p.Ile70Thr | |||||
F14F3.1a.1:c.686T>C | |||||
HGVSg | CHROMOSOME_X:g.10516476T>C | ||||
Sequence_details | SMap | S_parent | Sequence | F14F3 | |
Flanking_sequences | gaaacagaacctcgtttacgcaagtccaga | tgagagtcttgaaaaaggtgattaatttag | |||
Mapping_target | F14F3 | ||||
Type_of_mutation | Substitution | t | c | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00004472 | ||||
Laboratory | CB | ||||
Status | Live | ||||
Affects | Gene | WBGene00006870 | |||
Transcript | F14F3.1c.1 (12) | ||||
F14F3.1a.1 (12) | |||||
F14F3.1a.2 (12) | |||||
F14F3.1b.1 (12) | |||||
Interactor | WBInteraction000008524 | ||||
WBInteraction000008525 | |||||
WBInteraction000008526 | |||||
WBInteraction000008527 | |||||
WBInteraction000008528 | |||||
WBInteraction000008529 | |||||
WBInteraction000008530 | |||||
WBInteraction000502967 | |||||
WBInteraction000502968 | |||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00002235 | |
Genetics | Interpolated_map_position | X | 2.22447 | ||
Mapping_data (3) | |||||
Description | Phenotype (2) | ||||
Reference | WBPaper00014082 | ||||
WBPaper00014771 | |||||
WBPaper00014314 | |||||
WBPaper00017246 | |||||
Remark | In addition to the curated lesion, e1796 also carries a T to A substitituion with flanking sequences of cctcgtttacgcaagtccagattgagagtc & tgagagtcttgaaaaaggtgattaatttag giving rise to a L(232)H mutation. | Paper_evidence | WBPaper00002235 | ||
WBPaper00024640 | |||||
Method | Substitution_allele |