WormBase Tree Display for Variation: WBVar00144308
expand all nodes | collapse all nodes | view schema
| WBVar00144308 | Name (3) | ||||
|---|---|---|---|---|---|
| Sequence_details (5) | |||||
| Variation_type | Allele | ||||
| Origin (4) | |||||
| Affects (3) | |||||
| Isolation | Mutagen | EMS | Paper_evidence | WBPaper00002235 | |
| Genetics (2) | |||||
| Description | Phenotype (2) | ||||
| Reference (4) | |||||
| Remark | In addition to the curated lesion, e1796 also carries a T to A substitituion with flanking sequences of cctcgtttacgcaagtccagattgagagtc & tgagagtcttgaaaaaggtgattaatttag giving rise to a L(232)H mutation. | Paper_evidence (2) | |||
| Method | Substitution_allele |
