WormBase Tree Display for Variation: WBVar00144308
expand all nodes | collapse all nodes | view schema
WBVar00144308 | Name | Public_name | e1796 | ||||
---|---|---|---|---|---|---|---|
Other_name (7) | |||||||
HGVSg | CHROMOSOME_X:g.10516476T>C | ||||||
Sequence_details | SMap | S_parent | Sequence | F14F3 | |||
Flanking_sequences | gaaacagaacctcgtttacgcaagtccaga | tgagagtcttgaaaaaggtgattaatttag | |||||
Mapping_target | F14F3 | ||||||
Type_of_mutation | Substitution | t | c | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004472 | ||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006870 | |||||
Transcript | F14F3.1c.1 (12) | ||||||
F14F3.1a.1 (12) | |||||||
F14F3.1a.2 (12) | |||||||
F14F3.1b.1 (12) | |||||||
Interactor | WBInteraction000008524 | ||||||
WBInteraction000008525 | |||||||
WBInteraction000008526 | |||||||
WBInteraction000008527 | |||||||
WBInteraction000008528 | |||||||
WBInteraction000008529 | |||||||
WBInteraction000008530 | |||||||
WBInteraction000502967 | |||||||
WBInteraction000502968 | |||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00002235 | |||
Genetics | Interpolated_map_position | X | 2.22447 | ||||
Mapping_data | In_2_point | 672 | |||||
In_multi_point (6) | |||||||
In_pos_neg_data | 4703 | ||||||
Description | Phenotype | WBPhenotype:0000093 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | abnormal lineages for HO, H1, G1 and G2; Mig defects in DTC | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000195 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Mig defects in DTC | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00014082 | ||||||
WBPaper00014771 | |||||||
WBPaper00014314 | |||||||
WBPaper00017246 | |||||||
Remark | In addition to the curated lesion, e1796 also carries a T to A substitituion with flanking sequences of cctcgtttacgcaagtccagattgagagtc & tgagagtcttgaaaaaggtgattaatttag giving rise to a L(232)H mutation. | Paper_evidence | WBPaper00002235 | ||||
WBPaper00024640 | |||||||
Method | Substitution_allele |