WormBase Tree Display for Variation: WBVar00143865
expand all nodes | collapse all nodes | view schema
WBVar00143865 | Evidence | Paper_evidence | WBPaper00006502 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1256 | |||||||
Other_name | ZK381.1a.1:c.71C>T | ||||||||
CE07625:p.Thr24Met | |||||||||
HGVSg | CHROMOSOME_IV:g.6977596C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK381 | |||||
Flanking_sequences | aaattcctatagccagccagtggaaggcca | gtttcccgttgatctagagattgaaaaaaa | |||||||
Mapping_target | ZK381 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004278 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001862 | |||||||
Transcript | ZK381.1a.1 (12) | ||||||||
Interactor | WBInteraction000558062 | ||||||||
WBInteraction000558063 | |||||||||
WBInteraction000558064 | |||||||||
Genetics | Interpolated_map_position | IV | 3.26859 | ||||||
Mapping_data | In_pos_neg_data | 5437 | |||||||
5438 | |||||||||
5439 | |||||||||
5440 | |||||||||
5441 | |||||||||
5442 | |||||||||
5443 | |||||||||
Description | Phenotype (8) | ||||||||
Phenotype_not_observed | WBPhenotype:0000517 | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are indistinguishable from wild type in terms of behavior. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Both hermaphrodites and males are indistinguishable from wild type in terms of superficial anatomy. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001631 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The sex ratio of cross progeny sired by him males does not significantly differ from 1:1. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (7) | |||||||||
Method | Substitution_allele |