WormBase Tree Display for Variation: WBVar00142960
expand all nodes | collapse all nodes | view schema
WBVar00142960 | Evidence | Person_evidence | WBPerson21026 | |||||
---|---|---|---|---|---|---|---|---|
Name (3) | ||||||||
Sequence_details | SMap | S_parent | Sequence | R12H7 | ||||
Flanking_sequences | ttacactgaccgaaattaaaccccatttca | gatggtgttttcctacttcgtatggttgca | ||||||
Mapping_target | R12H7 | |||||||
Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson21026 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (19) | ||||||||
Laboratory (2) | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006749 | ||||||
Transcript | R12H7.1a.2 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | R12H7.1a.2:c.1039-1G>A | |||||||
Intron_number | 9/10 | |||||||
R12H7.1a.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | R12H7.1a.1:c.1039-1G>A | |||||||
Intron_number | 8/9 | |||||||
R12H7.1b.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | R12H7.1b.1:c.847-1G>A | |||||||
Intron_number | 5/5 | |||||||
Interactor | WBInteraction000052321 | |||||||
WBInteraction000052323 | ||||||||
WBInteraction000052325 | ||||||||
WBInteraction000518927 | ||||||||
WBInteraction000518931 | ||||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | X | 10.3258 | |||||
Mapping_data (3) | ||||||||
Description | Phenotype (25) | |||||||
Phenotype_not_observed | WBPhenotype:0001611 | Paper_evidence | WBPaper00000958 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit normal halothane sensitivity. | Paper_evidence | WBPaper00000958 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001612 | Paper_evidence | WBPaper00002358 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals have a similar EC50 (1020 30mM) compared to N2 (1050 25 mM). | Paper_evidence | WBPaper00002358 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | 50 animals were scored for mobility for 10 sec. at each concentration of ethanol after 5 min exposure. EC50's (concentration at which 50% of the animals were immobile for >10 sec) were determined from a dose response curve over a minimum of 12 concentrations (mM). Immobility was used an as endpoint. Upon removal from ethanol, immobility was reversible within 10-15 min. Treatment and scoring of anesthetic responses are described in Sedensky and Meneely, 1987; Morgan et al. , 1990; Morgan and Sedensky, 1994. | Paper_evidence | WBPaper00002358 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 22-24C | Paper_evidence | WBPaper00002358 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00043908 | |||||||
WBPaper00013842 | ||||||||
WBPaper00000031 | ||||||||
WBPaper00000958 | ||||||||
WBPaper00016500 | ||||||||
WBPaper00002358 | ||||||||
WBPaper00025689 | ||||||||
WBPaper00033075 | ||||||||
WBPaper00065757 | ||||||||
Method | Substitution_allele |