WormBase Tree Display for Variation: WBVar00095130
expand all nodes | collapse all nodes | view schema
WBVar00095130 | Evidence | Paper_evidence | WBPaper00004715 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | p813 | |||||||
Other_name | CE28361:p.Gln479Ter | ||||||||
Y41G9A.1.1:c.1435C>T | |||||||||
HGVSg | CHROMOSOME_X:g.2988002C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y41G9A | |||||
Flanking_sequences | gaccgctataatgcgcatgctcaagtcaac | aaggcaacattgcgtacatgaacggcgatt | |||||||
Mapping_target | Y41G9A | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030797 | ||||||||
Laboratory | PR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003885 | |||||||
Transcript | Y41G9A.1.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y41G9A.1.1:c.1435C>T | ||||||||
HGVSp | CE28361:p.Gln479Ter | ||||||||
cDNA_position | 1450 | ||||||||
CDS_position | 1435 | ||||||||
Protein_position | 479 | ||||||||
Exon_number | 11/17 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000500417 | ||||||||
WBInteraction000502137 | |||||||||
Genetics | Interpolated_map_position | X | -12.6622 | ||||||
Mapping_data | In_2_point | 376 | |||||||
377 | |||||||||
3384 | |||||||||
In_multi_point | 1209 | ||||||||
1210 | |||||||||
1211 | |||||||||
1212 | |||||||||
In_pos_neg_data | 3180 | ||||||||
5450 | |||||||||
Description | Phenotype | WBPhenotype:0000013 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00038169 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000238 | Paper_evidence | WBPaper00035062 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Foraging behavior was reduced compared to control | Paper_evidence | WBPaper00035062 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000249 | Paper_evidence | WBPaper00000082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not avoid high concentrations of fructose of NaCl. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00002899 | Paper_evidence | WBPaper00000082 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00003571 | Paper_evidence | WBPaper00000082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000263 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | severely shortened axonemes | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000303 | Paper_evidence | WBPaper00024944 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000304 | Paper_evidence | WBPaper00035062 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Chemotaxis to isoamyl alcohol was reduced compared to control | Paper_evidence | WBPaper00035062 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000310 | Paper_evidence | WBPaper00035062 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The ASER neuron lacks ciliary projections in osm-5(p813) and osm-6(p811) IFT mutants | Paper_evidence | WBPaper00035062 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | FITC occasionally stains ray sensilla. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000615 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Middle and distal segments of all cilia are absent. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000649 | Paper_evidence | WBPaper00003680 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | males are defective in vulva-location behavior | Paper_evidence | WBPaper00003680 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | him-5 | Paper_evidence | WBPaper00003680 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000663 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | fails to avoid 4M fructose or 4M NaCl | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00000932 | |||||||
WBPaper00035062 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2021 | |||||||||
Remark | Mating efficiency 1; less than 1% of WT mating efficiency. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Male mating efficiency was reduced compared to control | Paper_evidence | WBPaper00035062 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000932 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | him-5(e1490) | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000881 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ectopic assembly of ciliary structures and microtubules in many sensory neurons | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001414 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | poor mating | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001438 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Defective in chemotaxis to volatile odorants including benzaldehyde, 2-butanone and isoamyl alcohol (Data not shown). | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001462 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | poor chemotaxis to NaCl | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001530 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | FITC occasionally stains CEP. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | FITC occasionally stains ADE or PDE. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002053 | Paper_evidence | WBPaper00055368 | |||||||
Curator_confirmed | WBPerson466 | ||||||||
Remark | survive 10nM ivermectin | Paper_evidence | WBPaper00055368 | ||||||
Curator_confirmed | WBPerson466 | ||||||||
Affected_by | Molecule | WBMol:00002786 | Paper_evidence | WBPaper00055368 | |||||
Curator_confirmed | WBPerson466 | ||||||||
WBPhenotype:0002115 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | males suicidal | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00002087 | |||||||
WBPaper00000932 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Defects in dye filling. | Paper_evidence | WBPaper00002087 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
FITC does not stain amphids or phasmids. | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
fails to take up FITC | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004004 | Paper_evidence | WBPaper00003680 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | males are response defective | Paper_evidence | WBPaper00003680 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | him-5 | Paper_evidence | WBPaper00003680 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000067 | Paper_evidence | WBPaper00003582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mutants showed a normal feeding inhibition response when exposed to either cadmium or captan | Paper_evidence | WBPaper00003582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00000932 | |||||||
WBPaper00000082 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed normal sensitivity to light head and tail tapping with a human eyelash. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | |||||||
WBPaper00000082 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were able to track isothermally. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
normal thermotaxis | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals moved normally. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001015 | Paper_evidence | WBPaper00000082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not display any major developmental defects compared to N2 animals. | Paper_evidence | WBPaper00000082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001741 | Paper_evidence | WBPaper00032000 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males displayed no spontaneous spicule-muscle seizures in the presence or absence of food. | Paper_evidence | WBPaper00032000 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005826 | PATO:0000460 | Paper_evidence | WBPaper00032000 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005312 | PATO:0000460 | Paper_evidence | WBPaper00032000 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00032000 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | To effect food deprivation animals were moved to plates with no food (E. coli) or fed inedible bacteria (aztreonam-treated E. coli). | Paper_evidence | WBPaper00032000 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00038169 | ||||||||
WBPaper00029013 | |||||||||
WBPaper00000932 | |||||||||
WBPaper00031936 | |||||||||
WBPaper00029016 | |||||||||
WBPaper00002087 | |||||||||
WBPaper00001786 | |||||||||
WBPaper00024049 | |||||||||
WBPaper00011136 | |||||||||
WBPaper00032000 | |||||||||
WBPaper00035062 | |||||||||
WBPaper00003680 | |||||||||
WBPaper00000082 | |||||||||
WBPaper00024944 | |||||||||
WBPaper00016325 | |||||||||
WBPaper00003582 | |||||||||
WBPaper00055368 | |||||||||
WBPaper00061175 | |||||||||
WBPaper00064927 | |||||||||
WBPaper00065813 | |||||||||
Remark | Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||||
Method | Substitution_allele |