WormBase Tree Display for Variation: WBVar00091915
expand all nodes | collapse all nodes | view schema
WBVar00091915 | Name | Public_name | ok631 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C08F8.8.1:c.366+309_806+23del | ||||||||
HGVSg | CHROMOSOME_IV:g.11172510_11173661del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C08F8 | |||||
Flanking_sequences | aggtgaaaagttgtcggttgctgtacaaat | ttttcaattttcttatttttggaataatgt | |||||||
Mapping_target | C08F8 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok631_external | ||||||||
ok631_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00029536 | ||||||||
WBStrain00035755 | |||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00196519 | |||||||
WBGene00003657 | |||||||||
Transcript | C08F8.8.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C08F8.8.1:c.366+309_806+23del | ||||||||
Intron_number | 5-7/9 | ||||||||
Exon_number | 6-7/10 | ||||||||
C08F8.10 | VEP_consequence | non_coding_transcript_exon_variant | |||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | ?-30 | ||||||||
Exon_number | 1/1 | ||||||||
Interactor | WBInteraction000504024 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Mapping_data | In_multi_point | 4526 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00035106 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Emb | Paper_evidence | WBPaper00035106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00035106 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000054 | Paper_evidence | WBPaper00035106 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Early larval arrest phenotype | Paper_evidence | WBPaper00035106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00035106 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000073 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Arrested L1 larvae displayed variable defects in tail morphology, including kinks, bulges, and forks. Tail morphology defects were not observed in later stage escapers. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000081 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Homozygous mutants usually arrested development as embryos or L1 larvae. Homozygous ok631 adult escapers were never recovered. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00039839 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000134 | Paper_evidence | WBPaper00035106 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In lsy-9 mutants, che-1 expression is lost in a large fraction of animals | Paper_evidence | WBPaper00035106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00035106 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | che-1::yfp (otIs188) | Paper_evidence | WBPaper00035106 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000354 | Paper_evidence | WBPaper00035106 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Loss of bilaterally expressed markers reveals overall differentiation defect of ASE | Paper_evidence | WBPaper00035106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00035106 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | ceh-36 (otIs151), flp-6 (otIs125), che-1 (otIs188), osm-6 (oyIs59) | Paper_evidence | WBPaper00035106 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Arrested L1 appeared slightly uncoordinated in comparison to heterozygous sisters. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000704 | Paper_evidence | WBPaper00035106 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The excretory canal cell displayed cystic phenotypes | Paper_evidence | WBPaper00035106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00035106 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | pes-6::gfp (bgIs312) | Paper_evidence | WBPaper00035106 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000708 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Arrested L1 larvae had grossly normal intestines. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000709 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Arrested L1 larvae had grossly normal pharynxes. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000778 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Over 90% of arrested larvae did not have any bacteria in their gut, suggesting that most nhr-67 homozygous mutantsare unable to eat. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000867 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Homozygous mutants usually arrested development as embryos or L1 larvae. Homozygous ok631 adult escapers were never recovered. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00039839 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Arrested L1 larvae had grossly normal cuticular alae. | Paper_evidence | WBPaper00039839 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001510 | Paper_evidence | WBPaper00035106 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | ASE expression of the cilia marker osm-6 is lost in lsy-9 mutants. lsy-9 affects the identity of many distinct neuron types; Both AUA and ASJ failed to undergo the normal differentiation program in nhr-67 mutants. Pan-neuronal fate is executed normally | Paper_evidence | WBPaper00035106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00035106 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | osm- 6::gfp (oyIs59), See Table S1 for non-ASE markers | Paper_evidence | WBPaper00035106 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00035106 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | lsy-9 mutants display a complex phenotype in the development of left/right asymmetric ASE neurons. | Paper_evidence | WBPaper00035106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00035106 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035106 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | gcy-7 (otIs3), lim-6 (otIs114), gcy-5 (ntIs1) | Paper_evidence | WBPaper00035106 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00039839 | ||||||||
WBPaper00035106 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |