WormBase Tree Display for Variation: WBVar00091811
expand all nodes | collapse all nodes | view schema
WBVar00091811 | Name | Public_name | ok524 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T01C8.1c.1:c.301_591-57del | |||||||
T01C8.1b.1:c.487_777-57del | ||||||||
T01C8.1a.1:c.487_777-57del | ||||||||
HGVSg | CHROMOSOME_X:g.16800225_16800632del | |||||||
Sequence_details | SMap | S_parent | Sequence | T01C8 | ||||
Flanking_sequences | gtcatcagtacaccttctgacattttcatg | tagaaatccaattaaagtaattgaacaaga | ||||||
Mapping_target | T01C8 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK524_external | |||||||
OK524_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000096 | |||||||
WBStrain00007674 | ||||||||
WBStrain00007693 | ||||||||
WBStrain00026437 | ||||||||
WBStrain00026544 | ||||||||
WBStrain00030637 | ||||||||
WBStrain00031468 | ||||||||
WBStrain00034665 | ||||||||
WBStrain00056770 | ||||||||
Laboratory | RB | |||||||
EN | ||||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00020142 | ||||||
Transcript | T01C8.1b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T01C8.1b.1:c.487_777-57del | |||||||
cDNA_position | 487-? | |||||||
CDS_position | 487-? | |||||||
Protein_position | 163-? | |||||||
Intron_number | 3/10 | |||||||
Exon_number | 3/11 | |||||||
T01C8.1c.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T01C8.1c.1:c.301_591-57del | |||||||
cDNA_position | 344-? | |||||||
CDS_position | 301-? | |||||||
Protein_position | 101-? | |||||||
Intron_number | 3/10 | |||||||
Exon_number | 3/11 | |||||||
T01C8.1a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T01C8.1a.1:c.487_777-57del | |||||||
cDNA_position | 489-? | |||||||
CDS_position | 487-? | |||||||
Protein_position | 163-? | |||||||
Intron_number | 4/11 | |||||||
Exon_number | 4/12 | |||||||
Interactor | WBInteraction000052905 | |||||||
WBInteraction000500819 | ||||||||
WBInteraction000503041 | ||||||||
WBInteraction000520355 | ||||||||
WBInteraction000521811 | ||||||||
WBInteraction000524514 | ||||||||
WBInteraction000524918 | ||||||||
WBInteraction000524919 | ||||||||
WBInteraction000524983 | ||||||||
WBInteraction000524984 | ||||||||
WBInteraction000524985 | ||||||||
WBInteraction000524986 | ||||||||
WBInteraction000524987 | ||||||||
WBInteraction000524988 | ||||||||
WBInteraction000524989 | ||||||||
WBInteraction000524990 | ||||||||
WBInteraction000525060 | ||||||||
WBInteraction000525062 | ||||||||
WBInteraction000525065 | ||||||||
WBInteraction000525303 | ||||||||
WBInteraction000525304 | ||||||||
WBInteraction000525305 | ||||||||
WBInteraction000525318 | ||||||||
WBInteraction000525319 | ||||||||
WBInteraction000525320 | ||||||||
WBInteraction000525321 | ||||||||
WBInteraction000525322 | ||||||||
WBInteraction000525323 | ||||||||
WBInteraction000525324 | ||||||||
WBInteraction000525332 | ||||||||
WBInteraction000525333 | ||||||||
WBInteraction000525334 | ||||||||
WBInteraction000525335 | ||||||||
WBInteraction000525336 | ||||||||
WBInteraction000525337 | ||||||||
WBInteraction000525338 | ||||||||
WBInteraction000532888 | ||||||||
WBInteraction000535446 | ||||||||
WBInteraction000535451 | ||||||||
Isolation | Mutagen | UV/TMP | ||||||
Genetics | Mapping_data | In_multi_point | 5059 | |||||
Description | Phenotype | WBPhenotype:0000018 | Paper_evidence | WBPaper00045372 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | aak-2(ok524) mutants exhibited an increased pharyngeal pumping rate (Figure S1C) | Paper_evidence | WBPaper00045372 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000023 | Paper_evidence | WBPaper00045372 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | While both wild type and aak-2 deficient animals became paralyzed with increasing doses of exogenous serotonin, aak-2 mutants were more sensitive to paralyzing effects of high doses of serotonin, consistent with the notion that these mutants already experience elevated serotonin signaling (Figure S1B). | Paper_evidence | WBPaper00045372 | |||||
Curator_confirmed | WBPerson2987 | |||||||
aak-2 mutants were more sensitive to deleterious effects of elevated 5-HT, such that elevating the dose of exogenous 5-HT beyond 10 mM had a feeding reducing effect accompanied by other signs of sickness (Figure S1C). | Paper_evidence | WBPaper00045372 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004929 | Paper_evidence | WBPaper00045372 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000026 | Paper_evidence | WBPaper00032396 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | In a daf-2(e1370) mutant background, aak-2(ok524) causes dauer animals to exhibit reduced lipid content, as determined by Sudan Black staining, four days after the dauer larval molt (compare Figures 2c and 2d; also Figure 2k). Expression of the aak-2 cDNA in the hypodermis using the dpy-7 promoter can rescue the lipid depleted phenotype (Figure 2g). | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Rescued_by_transgene | WBTransgene00020821 | |||||||
WBTransgene00020822 | ||||||||
Phenotype_assay | Treatment | Dauer larva were stained with Sudan Black to visualize lipid content | Paper_evidence | WBPaper00032396 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Genotype | daf-2(e1370) | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000041 | Paper_evidence | WBPaper00032396 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | 8-day-old aak-2(ok524);daf-2(e1370) double mutant dauers exhibited fluid or fluid-filled vesicles in the body cavity, suggestive of defective osmoregulation (Figure 3c, bottom panel), a defect not seen in daf-2(e1370) dauers | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00032396 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000114 | Paper_evidence | WBPaper00045372 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The aak-2(ok524) mutation resulted in significant changes in mRNA levels for several metabolic genes, as determined by qRT-PCR (Figure S1D, Table S1) | Paper_evidence | WBPaper00045372 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000125 | Paper_evidence | WBPaper00032396 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | In the daf-2(e1370) mutant background, the aak-2(ok524) mutation results in increased lipase activity (Figure 2l) | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | For the lipase assay, dauers (day 0) were homogenized in a 20% glycerol, 0.1M KCl, 20mM HEPES (pH 7.6) buffer essentially as previously described. Lipase activity was quantified with a commercially-available QuantiChrom kit from BioAssay Systems according to the manufacturer's recommendations. | Paper_evidence | WBPaper00032396 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Genotype | daf-2(e1370) | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000127 | Paper_evidence | WBPaper00045372 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The aak-2(ok524) mutation resulted in premature exit from the dauer state, compared to controls (Figure 4A); rescue in Figure 6A | Paper_evidence | WBPaper00045372 | |||||
Curator_confirmed | WBPerson2987 | |||||||
The aak-2(ok524) mutation resulted in premature exit from the dauer state, compared to controls (Figure 4B) | Paper_evidence | WBPaper00045372 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Rescued_by_transgene | WBTransgene00021188 | |||||||
Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00045372 | ||||
Curator_confirmed | WBPerson2987 | |||||||
daf-7(e1372) | Paper_evidence | WBPaper00045372 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000462 | Paper_evidence | WBPaper00031692 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | aak-2 mutant worms showed hypersensitivity to paraquat | Paper_evidence | WBPaper00031692 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00031692 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035656 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Lower age pigments in aak-2(ok524) mutants treated with 50 mM metformin vs. controls. Nile Red staining was unaffected | Paper_evidence | WBPaper00035656 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00035656 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00041842 | ||||||
WBPaper00049105 | ||||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table SIII; note that this conflicts with data in Table 2 reporting that aak-2(ok524) does not significantly affect life span | Paper_evidence | WBPaper00041842 | |||||
Curator_confirmed | WBPerson2987 | |||||||
"To test a function of mitochondrial stress signaling in tumor survival during starvation, we used mutants in this signaling pathway, prdx-2(gk169) and aak-2(ok425). After induction of tumor formation by gld-1 RNAi, we performed life span analysis either under feeding (aak-2 and prdx-2; Figure 9B and S6A) or starvation conditions (aak-2 only; Figs 9C and S6B)... Notably, life span under feeding in animals with tumors depends on both aak-2 and prdx-2 function (Fig 9B), whereas starvation-induced life span extension is not affected in the aak-2 mutant (Fig 9C), consistent with recent findings." | Paper_evidence | WBPaper00049105 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
"Moreover, glucose restriction by DOG only extends life span in wild-type animals but not in aak-2 mutants (Fig 9C)" | Paper_evidence | WBPaper00049105 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004845 | Paper_evidence | WBPaper00049105 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Feeding conditions | Paper_evidence | WBPaper00049105 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Fasting conditions and treated with 2-deoxy-D-glucose (DOG) | Paper_evidence | WBPaper00049105 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Genotype | gld-1(RNAi) | Paper_evidence | WBPaper00049105 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001183 | Paper_evidence | WBPaper00045372 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | To determine whether loss of aak-2 mimics the effects of elevated serotonin on fat, authors assessed fat content using the fluorescent BODIPY-labeled fatty acids and biochemical measurement of triacylglycerides, both of which indicated that aak-2 mutants had reduced fat compared to wild type (Figure 1B-C). To verify these results, authors used Coherent anti-Stokes Raman Scattering, CARS, a label free microscopic method for the assessment of fat levels. The CARS results corroborated the noted fat reduction upon aak-2 inactivation and 5 mM serotonin treatment (Figure 1D-E). Moreover, the notion that aak-2 mutants have particularly low fat levels in their skin-like hypodermal tissues, a result readily suggested by treatment of these mutants with BODIPY-labeled fatty acids (Figure 1B), was corroborated by CARS (Figure 1E). | Paper_evidence | WBPaper00045372 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Multiple independent methods of assessing fat levels vita staining with BODIPY-labeled fatty acids, fixed staining with Sudan Black B, and total lipid extraction followed by thin layer chromatography, Coherent anti-Stokes Raman Scattering, CARS all showed significant reductions in lipid levels in daf-2;aak-2 relative to daf-2 mutants, both prior to and at the time of dauer entry (Figure 3, S5, S6). | Paper_evidence | WBPaper00045372 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Multiple independent methods of assessing fat levels vital staining with BODIPY-labeled fatty acids, fixed staining with Sudan Black B, and total lipid extraction followed by thin layer chromatography all showed significant reductions in lipid levels in daf-7;aak-2 relative to daf-7 mutants, both prior to and at the time of dauer entry (Figure 3, S5). | Paper_evidence | WBPaper00045372 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Rescued_by_transgene | WBTransgene00021186 | |||||||
Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00045372 | ||||
Curator_confirmed | WBPerson2987 | |||||||
daf-7(e1372) | Paper_evidence | WBPaper00045372 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001351 | Paper_evidence | WBPaper00031692 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The paraquat treatment-dependent AAK-2 phosphorylation was absent in aak-2(gt33) and aak-2(ok524) worms | Paper_evidence | WBPaper00031692 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001482 | Paper_evidence | WBPaper00045372 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | aak-2 deficient animals had reduced movement rate off-food (Figure 1A) | Paper_evidence | WBPaper00045372 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Rescued_by_transgene | WBTransgene00021186 | |||||||
WBPhenotype:0001513 | Paper_evidence | WBPaper00045372 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Loss of aak-2 increased accumulation of the DAF-28::mCherry reporter (Figure 5B, 5D, S7C) and the DAF-7::mCherry reporter (Figure S7A) in coelomocytes. | Paper_evidence | WBPaper00045372 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001838 | Paper_evidence | WBPaper00035656 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Metformin-induced SKN-1::GFP nuclear localization is strongly AMPK-dependent: in the aak-2(ok524) mutant background, metformin treatment no longer induces nuclear SKN-1::GFP accumulation | Paper_evidence | WBPaper00035656 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00035656 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001871 | Paper_evidence | WBPaper00035656 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Unlike wildtype, metformin treatment decreased mid-life viability in aak-2 mutants in a dose-dependent manner | Paper_evidence | WBPaper00035656 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00035656 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001872 | Paper_evidence | WBPaper00035656 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Unlike wildtype, metformin treatment reduced locomotory ability in aak-2 mutant strains | Paper_evidence | WBPaper00035656 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00035656 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001989 | Paper_evidence | WBPaper00034694 | ||||||
Curator_confirmed | WBPerson2857 | |||||||
Remark | animals enter into hypoxia-induced reproductive and developmental diapause in 5000 ppm oxygen, whereas wild-type animals continue development in this condition | Paper_evidence | WBPaper00034694 | |||||
Curator_confirmed | WBPerson2857 | |||||||
WBPhenotype:0002267 | Paper_evidence | WBPaper00035277 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Figure S12c | Paper_evidence | WBPaper00035277 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Animals were stained with Mitotracker Deep Red 633 to visualize intestinal mitochondria | Paper_evidence | WBPaper00035277 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002269 | Paper_evidence | WBPaper00032396 | ||||||
WBPaper00045372 | ||||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | In the daf-2(e1370) mutant background, the aak-2(ok524) mutation results in increased oxygen consumption (Figure 2m) | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
aak-2 mutants exhibited elevated rates of oxygen consumption relative to wild type animals (Figure 1F). | Paper_evidence | WBPaper00045372 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00032396 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002276 | Paper_evidence | WBPaper00032396 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | aak-2(ok524);daf-2(e1370) double mutant animals exhibited a significantly reduced dauer life span compared to control daf-2(e1370) mutant animals (Table 1, Figure 1b) | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
aak-2(ok524) mutants exhibited a significantly reduced dauer life span compared to wild type (N2) controls (Figure 1b) | Paper_evidence | WBPaper00032396 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
aak-2(ok524);daf-7(e1372) double mutant animals exhibited a significantly reduced dauer life span compared to control daf-7(e1372) mutant animals (Figure 1b) | Paper_evidence | WBPaper00032396 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Rescued_by_transgene | WBTransgene00020806 | |||||||
WBTransgene00020807 | ||||||||
WBTransgene00020808 | ||||||||
WBTransgene00020809 | ||||||||
WBTransgene00020810 | ||||||||
WBTransgene00020811 | ||||||||
WBTransgene00020812 | ||||||||
WBTransgene00020813 | ||||||||
WBTransgene00020814 | ||||||||
WBTransgene00020821 | ||||||||
WBTransgene00020822 | ||||||||
WBTransgene00020828 | ||||||||
WBTransgene00020829 | ||||||||
WBTransgene00020830 | ||||||||
WBTransgene00020831 | ||||||||
WBTransgene00020832 | ||||||||
WBTransgene00020833 | ||||||||
Phenotype_assay | Treatment | C. elegans were synchronized and plated at 25 degrees Celsius. Three days later, ~10 dauer larvae were randomly picked into a 20 microliter drop of double-distilled water suspended under a Petri dish cover. A wet tissue was placed in the bottom of the dish to maintain humidity, and the plate was sealed with Parafilm. Dauer longevity was monitored daily, and survival was scored as moving response upon exposure to a focused beam of 425-440 nm light. | Paper_evidence | WBPaper00032396 | ||||
Curator_confirmed | WBPerson2987 | |||||||
C. elegans dauer formation was induced at 15 degrees Celsius by crowding/starvation. ~10 dauer larvae were randomly picked into a 20 microliter drop of double-distilled water suspended under a Petri dish cover. A wet tissue was placed in the bottom of the dish to maintain humidity, and the plate was sealed with Parafilm. Dauer longevity was monitored daily, and survival was scored as moving response upon exposure to a focused beam of 425-440 nm light. Dauer life span was assayed at 25 degrees Celsius. | Paper_evidence | WBPaper00032396 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Temperature | 25 | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Genotype | daf-2(e1370) | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
daf-7(e1372) | Paper_evidence | WBPaper00032396 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002281 | Paper_evidence | WBPaper00032396 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | 4-day-old daf-2(e1370);aak-2(ok524) double mutant dauers exhibit a hypersensitivity to osmotic stress (high concentrations of sodium chloride (NaCl)) compared to 4-day-old daf-2(e1370) dauers (Figure 3b). Also, addition of NaCl (20mM and 50mM) to plates resulted in reduced dauer lifespan of daf-2(e1370);aak-2(ok524) double mutant dauers compared to daf-2(e1370) dauers (Figure 3d). | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032396 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00032396 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00041842 | |||||
WBPaper00049105 | ||||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 2; note that this conflicts with data in Table SIII reporting that aak-2(ok524) results in a significantly reduced life span | Paper_evidence | WBPaper00041842 | |||||
Curator_confirmed | WBPerson2987 | |||||||
"To test a function of mitochondrial stress signaling in tumor survival during starvation, we used mutants in this signaling pathway, prdx-2(gk169) and aak-2(ok425). After induction of tumor formation by gld-1 RNAi, we performed life span analysis either under feeding (aak-2 and prdx-2; Figure 9B and S6A) or starvation conditions (aak-2 only; Figs 9C and S6B)... Notably, life span under feeding in animals with tumors depends on both aak-2 and prdx-2 function (Fig 9B), whereas starvation-induced life span extension is not affected in the aak-2 mutant (Fig 9C), consistent with recent findings." | Paper_evidence | WBPaper00049105 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Fasting conditions | Paper_evidence | WBPaper00049105 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Genotype | gld-1(RNAi) | Paper_evidence | WBPaper00049105 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000114 | Paper_evidence | WBPaper00045372 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | mRNA levels of tph-1 and aak-1 (Figure S3), as well as daf-7, daf-28, and ser-5 (Figure S7B) were not affected by the aak-2(ok524) mutation | Paper_evidence | WBPaper00045372 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000876 | Paper_evidence | WBPaper00032396 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | aak-2(ok524) animals do not exhibit changes in response to osmotic stress (high concentrations of sodium chloride (NaCl)) compared to wild type controls (Figure 3a) | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
aak-2(ok524) animals do not exhibit changes in response to osmotic stress (high concentrations of sodium chloride (NaCl)) in a daf-2(e1370) mutant background (Figure 3a) | Paper_evidence | WBPaper00032396 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032396 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00032396 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00041842 | |||||||
WBPaper00035656 | ||||||||
WBPaper00035277 | ||||||||
WBPaper00034694 | ||||||||
WBPaper00031692 | ||||||||
WBPaper00032396 | ||||||||
WBPaper00025901 | ||||||||
WBPaper00045372 | ||||||||
WBPaper00049105 | ||||||||
WBPaper00061997 | ||||||||
WBPaper00064980 | ||||||||
WBPaper00064979 | ||||||||
WBPaper00065359 | ||||||||
WBPaper00065265 | ||||||||
WBPaper00065271 | ||||||||
WBPaper00065803 | ||||||||
WBPaper00065845 | ||||||||
WBPaper00066013 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |