WormBase Tree Display for Variation: WBVar00091811
expand all nodes | collapse all nodes | view schema
WBVar00091811 | Name | Public_name | ok524 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T01C8.1c.1:c.301_591-57del | |||||||
T01C8.1b.1:c.487_777-57del | ||||||||
T01C8.1a.1:c.487_777-57del | ||||||||
HGVSg | CHROMOSOME_X:g.16800225_16800632del | |||||||
Sequence_details | SMap | S_parent | Sequence | T01C8 | ||||
Flanking_sequences | gtcatcagtacaccttctgacattttcatg | tagaaatccaattaaagtaattgaacaaga | ||||||
Mapping_target | T01C8 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK524_external | |||||||
OK524_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000096 | |||||||
WBStrain00007674 | ||||||||
WBStrain00007693 | ||||||||
WBStrain00026437 | ||||||||
WBStrain00026544 | ||||||||
WBStrain00030637 | ||||||||
WBStrain00031468 | ||||||||
WBStrain00034665 | ||||||||
WBStrain00056770 | ||||||||
Laboratory (2) | ||||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00020142 | ||||||
Transcript | T01C8.1b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T01C8.1b.1:c.487_777-57del | |||||||
cDNA_position | 487-? | |||||||
CDS_position | 487-? | |||||||
Protein_position | 163-? | |||||||
Intron_number | 3/10 | |||||||
Exon_number | 3/11 | |||||||
T01C8.1c.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T01C8.1c.1:c.301_591-57del | |||||||
cDNA_position | 344-? | |||||||
CDS_position | 301-? | |||||||
Protein_position | 101-? | |||||||
Intron_number | 3/10 | |||||||
Exon_number | 3/11 | |||||||
T01C8.1a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T01C8.1a.1:c.487_777-57del | |||||||
cDNA_position | 489-? | |||||||
CDS_position | 487-? | |||||||
Protein_position | 163-? | |||||||
Intron_number | 4/11 | |||||||
Exon_number | 4/12 | |||||||
Interactor (39) | ||||||||
Isolation | Mutagen | UV/TMP | ||||||
Genetics | Mapping_data | In_multi_point | 5059 | |||||
Description | Phenotype (22) | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00041842 | |||||
WBPaper00049105 | ||||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 2; note that this conflicts with data in Table SIII reporting that aak-2(ok524) results in a significantly reduced life span | Paper_evidence | WBPaper00041842 | |||||
Curator_confirmed | WBPerson2987 | |||||||
"To test a function of mitochondrial stress signaling in tumor survival during starvation, we used mutants in this signaling pathway, prdx-2(gk169) and aak-2(ok425). After induction of tumor formation by gld-1 RNAi, we performed life span analysis either under feeding (aak-2 and prdx-2; Figure 9B and S6A) or starvation conditions (aak-2 only; Figs 9C and S6B)... Notably, life span under feeding in animals with tumors depends on both aak-2 and prdx-2 function (Fig 9B), whereas starvation-induced life span extension is not affected in the aak-2 mutant (Fig 9C), consistent with recent findings." | Paper_evidence | WBPaper00049105 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Fasting conditions | Paper_evidence | WBPaper00049105 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Genotype | gld-1(RNAi) | Paper_evidence | WBPaper00049105 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000114 | Paper_evidence | WBPaper00045372 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | mRNA levels of tph-1 and aak-1 (Figure S3), as well as daf-7, daf-28, and ser-5 (Figure S7B) were not affected by the aak-2(ok524) mutation | Paper_evidence | WBPaper00045372 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000876 | Paper_evidence | WBPaper00032396 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | aak-2(ok524) animals do not exhibit changes in response to osmotic stress (high concentrations of sodium chloride (NaCl)) compared to wild type controls (Figure 3a) | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
aak-2(ok524) animals do not exhibit changes in response to osmotic stress (high concentrations of sodium chloride (NaCl)) in a daf-2(e1370) mutant background (Figure 3a) | Paper_evidence | WBPaper00032396 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032396 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00032396 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference (18) | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |