WormBase Tree Display for Variation: WBVar00090954
expand all nodes | collapse all nodes | view schema
WBVar00090954 | Evidence | Paper_evidence | WBPaper00031700 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | nc40 | ||||||
Other_name | Y48G9A.3.1:c.2683+1932_3408del | |||||||
HGVSg | CHROMOSOME_III:g.2170080_2176959del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y48G9A | ||||
Flanking_sequences | agtggcacattttcgaggaatggaaggatt | cttgttggtacggacttttatgtgaaaatt | ||||||
Mapping_target | Y48G9A | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00034488 | |||||||
Laboratory | ST | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003293 | ||||||
WBGene00021697 | ||||||||
WBGene00003294 | ||||||||
WBGene00003322 | ||||||||
WBGene00003292 | ||||||||
Transcript | Y48G9A.13 | |||||||
Y48G9A.15 | ||||||||
Y48G9A.14 | ||||||||
Y48G9A.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y48G9A.3.1:c.2683+1932_3408del | |||||||
cDNA_position | ?-3447 | |||||||
CDS_position | ?-3408 | |||||||
Protein_position | ?-1136 | |||||||
Intron_number | 12-13/29 | |||||||
Exon_number | 13-14/30 | |||||||
Y48G9A.16 | ||||||||
Interactor (7) | ||||||||
Genetics | Interpolated_map_position | III | -15.062 | |||||
Description | Phenotype | WBPhenotype:0000199 | Paper_evidence | WBPaper00031700 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "To gain insight into SMPs signaling, we conducted a screen for mutations that suppress the ray 1 phenotype in plx-1 mutants. One isolated mutation, nc40, suppressed the ray defect in plx-1 as well as that in smp-1 smp-2 mutants (Fig 1D,H,I)." | Paper_evidence | WBPaper00031700 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | plx-1(nc37) | Paper_evidence | WBPaper00031700 | ||||
Curator_confirmed | WBPerson2987 | |||||||
smp-1(ev715) smp-2(ev709) | Paper_evidence | WBPaper00031700 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
plx-1(ev724) | Paper_evidence | WBPaper00031700 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001351 | Paper_evidence | WBPaper00031700 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "We carried out Western blot analysis to detect the level of eIF2α phosphorylation (P-eIF2α) in wild-type and gcn-1 mutant larvae at stage 1 (L1). In gcn-1 mutants, a reduction in P-eIF2α to 28% of wild type was observed (Fig 2A), indicating that GCN-1 does participate in the eIF2α phosphorylation." | Paper_evidence | WBPaper00031700 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000112 | Paper_evidence | WBPaper00031700 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | gcn-1(nc40) did not affect expression of UNC-60A | Paper_evidence | WBPaper00031700 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000298 | Paper_evidence | WBPaper00031700 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "nc40 single mutants displayed normal ray configuration (Supplemental Tables S1, S2)." | Paper_evidence | WBPaper00031700 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00031700 | |||||||
Method | Deletion_allele |