WormBase Tree Display for Variation: WBVar00090389
expand all nodes | collapse all nodes | view schema
WBVar00090389 | Evidence | Paper_evidence | WBPaper00028753 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n2231 | ||||||
Other_name | JC8.6d.1:c.1255G>A | |||||||
JC8.6c.1:c.1255G>A | ||||||||
CE17990:p.Ala416Thr | ||||||||
CE53077:p.Ala419Thr | ||||||||
CE53011:p.Ala419Thr | ||||||||
JC8.6a.1:c.1264G>A | ||||||||
CE17989:p.Ala422Thr | ||||||||
JC8.6b.1:c.1246G>A | ||||||||
HGVSg | CHROMOSOME_IV:g.13243115G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | JC8 | ||||
Flanking_sequences | acaactgagctcacacaagatcttgatgcc | ctccaacggatgacatcccaggaccatcta | ||||||
Mapping_target | JC8 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00028753 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00027346 | |||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003037 | ||||||
Transcript | JC8.6d.1 (12) | |||||||
JC8.6b.1 (12) | ||||||||
JC8.6c.1 (12) | ||||||||
JC8.6a.1 (12) | ||||||||
Interactor | WBInteraction000500868 | |||||||
WBInteraction000504626 | ||||||||
WBInteraction000504631 | ||||||||
Genetics | Interpolated_map_position | IV | 8.48466 | |||||
Description | Phenotype | WBPhenotype:0000059 | Paper_evidence | WBPaper00038168 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals show larval arrest at 26 deg C. | Paper_evidence | WBPaper00038168 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 26 | Paper_evidence | WBPaper00038168 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0001370 | Paper_evidence | WBPaper00038427 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "We next tested whether LIN-54 tesmin mutations affect DRM complex formation in addition to compromising DNA binding. Using yeast two-hybrid assays, we found that both wild-type and mutant LIN-54 proteins can interact with the DRM subunit LIN-9 (Figure 2C). In addition, other DRM complex members coprecipitated in lin-54(n2231) mutant animals (Figure 2D). These observations demonstrate that the tesmin mutation does not result in an unstable protein and does not compromise the integrity of the DRM complex. We conclude that the lin-54 tesmin mutant phenotypes are most likely caused by a defect in DNA binding." | Paper_evidence | WBPaper00038427 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00038168 | |||||||
WBPaper00038427 | ||||||||
WBPaper00028753 | ||||||||
Method | Substitution_allele |