WormBase Tree Display for Variation: WBVar00089301
expand all nodes | collapse all nodes | view schema
WBVar00089301 | Evidence | Paper_evidence | WBPaper00004497 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n179 | |||||||
Other_name | n179hs | ||||||||
n179ts | Paper_evidence | WBPaper00004497 | |||||||
CE03734:p.Arg301Gly | |||||||||
T25C12.1a.1:c.907A>G | |||||||||
CE43285:p.Arg303Gly | |||||||||
T25C12.1b.1:c.901A>G | |||||||||
HGVSg | CHROMOSOME_X:g.11483366A>G | ||||||||
Sequence_details | SMap | S_parent | Sequence | T25C12 | |||||
Flanking_sequences | ccagtgaatgacgacattgtcaaaattgtt | ggaatcaagatttgagcgaggagaatattt | |||||||
Mapping_target | T25C12 | ||||||||
Type_of_mutation | Substitution | a | g | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00006266 | ||||||||
WBStrain00026738 | |||||||||
WBStrain00040213 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003003 | |||||||
Transcript | T25C12.1b.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious_low_confidence | |||||||
PolyPhen | 0.992 | probably_damaging | |||||||
HGVSc | T25C12.1b.1:c.901A>G | ||||||||
HGVSp | CE03734:p.Arg301Gly | ||||||||
cDNA_position | 1032 | ||||||||
CDS_position | 901 | ||||||||
Protein_position | 301 | ||||||||
Exon_number | 7/12 | ||||||||
Codon_change | Agg/Ggg | ||||||||
Amino_acid_change | R/G | ||||||||
T25C12.1a.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious_low_confidence | |||||||
PolyPhen | 0.992 | probably_damaging | |||||||
HGVSc | T25C12.1a.1:c.907A>G | ||||||||
HGVSp | CE43285:p.Arg303Gly | ||||||||
cDNA_position | 1029 | ||||||||
CDS_position | 907 | ||||||||
Protein_position | 303 | ||||||||
Exon_number | 9/14 | ||||||||
Codon_change | Agg/Ggg | ||||||||
Amino_acid_change | R/G | ||||||||
Interactor | WBInteraction000051439 | ||||||||
WBInteraction000051440 | |||||||||
WBInteraction000052060 | |||||||||
WBInteraction000052067 | |||||||||
WBInteraction000052068 | |||||||||
WBInteraction000052069 | |||||||||
WBInteraction000052180 | |||||||||
WBInteraction000052181 | |||||||||
WBInteraction000052284 | |||||||||
WBInteraction000052289 | |||||||||
WBInteraction000052336 | |||||||||
WBInteraction000052338 | |||||||||
WBInteraction000052353 | |||||||||
WBInteraction000052432 | |||||||||
WBInteraction000052433 | |||||||||
WBInteraction000052434 | |||||||||
WBInteraction000052435 | |||||||||
WBInteraction000500329 | |||||||||
WBInteraction000501826 | |||||||||
WBInteraction000504444 | |||||||||
WBInteraction000520773 | |||||||||
WBInteraction000521365 | |||||||||
WBInteraction000521366 | |||||||||
WBInteraction000521369 | |||||||||
Isolation | Mutagen | spo | |||||||
Genetics | Interpolated_map_position | X | 3.86306 | ||||||
Mapping_data | In_2_point | 492 | |||||||
636 | |||||||||
637 | |||||||||
688 | |||||||||
3652 | |||||||||
In_multi_point | 410 | ||||||||
551 | |||||||||
552 | |||||||||
553 | |||||||||
647 | |||||||||
796 | |||||||||
1195 | |||||||||
1196 | |||||||||
1200 | |||||||||
1326 | |||||||||
1334 | |||||||||
1335 | |||||||||
1340 | |||||||||
1342 | |||||||||
1438 | |||||||||
1439 | |||||||||
3086 | |||||||||
3087 | |||||||||
3320 | |||||||||
3321 | |||||||||
In_pos_neg_data | 654 | ||||||||
668 | |||||||||
3155 | |||||||||
Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00050052 | |||||
Curator_confirmed | WBPerson5092 | ||||||||
WBPhenotype:0000093 | Paper_evidence | WBPaper00001144 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001144 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00001144 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00001144 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000113 | Paper_evidence | WBPaper00056201 | |||||||
Curator_confirmed | WBPerson44293 | ||||||||
Remark | Figure 2a, n719 mutants have reduced SL1-LCE expression at all larval stages | Paper_evidence | WBPaper00056201 | ||||||
Curator_confirmed | WBPerson44293 | ||||||||
WBPhenotype:0000170 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | At the restrictive temperature all seam cells fail to divide during the L3 molt and generate precocious alae instead, as scored by Normarski optics. At the permissive temp, animals are 100% WT in seam cell fate. At intermediate temperatures, the phenotype is incomplete. 30% seam cell nuclei are mutant in homozygous animals. 84% seam cell nuclei are mutant in hemizygous lin-14/Df animals. | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | At the nonpermissive temperature. | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006913 | PATO:0000460 | Paper_evidence | WBPaper00001011 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000172 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals have ectopic midbody seam cell nuclei (14 or more). | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005753 | PATO:0000460 | Paper_evidence | WBPaper00001011 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000417 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | At the restrictive temperature all seam cells fail to divide during the L3 molt and generate precocious alae instead as scored by Nomarski optics. | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | At the nonpermissive temperature. | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006913 | PATO:0000460 | Paper_evidence | WBPaper00001011 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000594 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Seam cell nuclei frequently deviate from the characteristic straight line. | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005753 | PATO:0000460 | Paper_evidence | WBPaper00001011 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001355 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Abnormal gonad morphology is usually observed in severe mutants. | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005178 | PATO:0000460 | Paper_evidence | WBPaper00001011 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001779 | Paper_evidence | WBPaper00056201 | |||||||
Curator_confirmed | WBPerson44293 | ||||||||
Remark | Figure 2c and 2d, n719 mutants have elevated let-7 levels | Paper_evidence | WBPaper00056201 | ||||||
Curator_confirmed | WBPerson44293 | ||||||||
Phenotype_not_observed | WBPhenotype:0000113 | Paper_evidence | WBPaper00056201 | ||||||
Curator_confirmed | WBPerson44293 | ||||||||
Remark | Figure 2a, n179 mutants have similar SL1-LCE expression as wild type | Paper_evidence | WBPaper00056201 | ||||||
Curator_confirmed | WBPerson44293 | ||||||||
WBPhenotype:0000718 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XO males exhibit a lin-14 phenotype similar to XX animals and much less severe than X/Df animals. | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00015364 | ||||||||
WBPaper00010936 | |||||||||
WBPaper00016053 | |||||||||
WBPaper00016555 | |||||||||
WBPaper00001011 | |||||||||
WBPaper00016419 | |||||||||
WBPaper00013845 | |||||||||
WBPaper00015363 | |||||||||
WBPaper00014071 | |||||||||
WBPaper00016093 | |||||||||
WBPaper00001144 | |||||||||
WBPaper00016421 | |||||||||
WBPaper00013709 | |||||||||
WBPaper00016257 | |||||||||
WBPaper00016228 | |||||||||
WBPaper00016175 | |||||||||
WBPaper00015417 | |||||||||
WBPaper00050052 | |||||||||
WBPaper00056201 | |||||||||
Method | Substitution_allele |