WormBase Tree Display for Variation: WBVar00088178
expand all nodes | collapse all nodes | view schema
WBVar00088178 | Evidence | Paper_evidence | WBPaper00006290 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ju406 | |||||||
Other_name | T22D2.1.1:c.415-1G>A | ||||||||
HGVSg | CHROMOSOME_II:g.2444104G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T22D2 | |||||
Flanking_sequences | aaaaagttagttgcaaattccaaattttca | aaaaaaacggtccaagacatcagaagccga | |||||||
Mapping_target | T22D2 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00006290 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CZ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006882 | |||||||
Transcript | T22D2.1.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T22D2.1.1:c.415-1G>A | ||||||||
Intron_number | 3/19 | ||||||||
Interactor | WBInteraction000519839 | ||||||||
Genetics | Interpolated_map_position | II | -13.8069 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00032244 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals typically hatched as lumpy two-fold embryos. | Paper_evidence | WBPaper00032244 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | vab-19(ju406)/Df | Paper_evidence | WBPaper00032244 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000409 | Paper_evidence | WBPaper00006290 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ju406 behaved indistinguishably from e1036 at 15C. | Paper_evidence | WBPaper00006290 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006290 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000494 | Paper_evidence | WBPaper00032244 | |||||||
WBPaper00006290 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Embryos stopped elongating within 5-10 minutes of the twofold stage. | Paper_evidence | WBPaper00032244 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
vab-19(ju406)/nDf2 animals also arrested at two-fold; ju406 behaved indistinguishably from e1036 at 15C | Paper_evidence | WBPaper00006290 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006290 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000019 | PATO:0000460 | Paper_evidence | WBPaper00032244 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | vab-19(ju406)/Df | Paper_evidence | WBPaper00032244 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001735 | Paper_evidence | WBPaper00032244 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Embryos did not show vigorous movement within the eggshell. | Paper_evidence | WBPaper00032244 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000021 | PATO:0000460 | Paper_evidence | WBPaper00032244 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | vab-19(ju406)/Df | Paper_evidence | WBPaper00032244 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00006290 | ||||||||
WBPaper00032244 | |||||||||
Method | Substitution_allele |