WormBase Tree Display for Variation: WBVar00088157
expand all nodes | collapse all nodes | view schema
WBVar00088157 | Evidence | Paper_evidence | WBPaper00005543 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ju82 | |||||||
Other_name (2) | |||||||||
HGVSg | CHROMOSOME_II:g.7591994G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | R07G3 | |||||
Flanking_sequences | accgcctcacgcagtcgcatgaatgccagt | aaccgcctcccggtgagtctttgaattttt | |||||||
Mapping_target | R07G3 | ||||||||
Type_of_mutation | Substitution | g | h | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005369 | ||||||||
Laboratory | CZ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006363 | |||||||
Transcript | F35D2.5a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F35D2.5a.1:c.211C>T | ||||||||
HGVSp | CE33391:p.Glu71Ter | ||||||||
cDNA_position | 215 | ||||||||
CDS_position | 211 | ||||||||
Protein_position | 71 | ||||||||
Exon_number | 4/19 | ||||||||
Codon_change | Gaa/Taa | ||||||||
Amino_acid_change | E/* | ||||||||
Interactor | WBInteraction000502715 | ||||||||
WBInteraction000502837 | |||||||||
WBInteraction000504813 | |||||||||
WBInteraction000523867 | |||||||||
WBInteraction000523870 | |||||||||
WBInteraction000541722 | |||||||||
Genetics | Interpolated_map_position | II | 0.504835 | ||||||
Description | Phenotype | WBPhenotype:0000545 | Paper_evidence | WBPaper00032993 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Defects in the egg-laying behavior in syd-1 mutants | Paper_evidence | WBPaper00032993 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000566 | Paper_evidence | WBPaper00005543 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | This allele was isolated in noncomplementation screens based on behavioural defects. | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Branch defects scored in PLM neuron. | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00045690 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | By gross movement, mutants show slow movement while maintaining a sinusoidal pattern. | Paper_evidence | WBPaper00045690 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000847 | Paper_evidence (2) | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | Numerous synaptic components (SNB-1, ELKS-1 and GIT-1) failed to localize to presynaptic sites in syd-1mutants | Paper_evidence | WBPaper00032993 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
SNB-1::GFP localization phenotypes are comparable to other ju2 and ju20 and to those of syd-1/Df animals, that is, there were fewer ventral SNB-1::GFP puncta in mutants than in wild-type animals, and they were slightly irregular in shape. In dorsal cords, the number of puncta was comparable to wild type; however the puncta shape were noticeably abnormal. | Paper_evidence | WBPaper00005543 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004758 | PATO:0000460 | Paper_evidence | WBPaper00032993 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | wyEx146 [Punc-86::git-1::yfp], wyEx196 [Punc-86::elks-1::yfp], kyIs235 [Punc-86::snb-1::yfp] | Paper_evidence | WBPaper00032993 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
juIs1[Punc-25::SNB-1::GFP] | Paper_evidence | WBPaper00005543 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001321 | Paper_evidence | WBPaper00045690 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals display distinctive alterations in presynaptic morphology, as visualized by the synaptic vesicle marker juIs1[Punc-25-SNB-1::GFP]. | Paper_evidence | WBPaper00045690 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Localization of the synaptic protein SNB-1 is normal, based on expression analysis of SNB-1::VENUS. | Paper_evidence | WBPaper00028886 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Reference | WBPaper00028886 | ||||||||
WBPaper00032993 | |||||||||
WBPaper00005543 | |||||||||
WBPaper00045690 | |||||||||
WBPaper00045955 | |||||||||
Method | Substitution_allele |