WormBase Tree Display for Variation: WBVar02151542
expand all nodes | collapse all nodes | view schema
WBVar02151542 | Name | Public_name | tm11200 | |||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | K03A1 | ||||
Flanking_sequences | atccagactatatcaatttgcgtctcgttc | cacaaagctcaaaaattgatgttgatgatg | ||||||
Mapping_target | K03A1 | |||||||
Source_location | 7 | CHROMOSOME_X | 7278081 | 7301627 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm11200_external | |||||||
tm11200_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 11200 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00197373 | ||||||
WBGene00198393 | ||||||||
WBGene00195687 | ||||||||
WBGene00006351 | ||||||||
WBGene00201334 | ||||||||
WBGene00195409 | ||||||||
WBGene00019351 | ||||||||
WBGene00006750 | ||||||||
WBGene00019352 | ||||||||
Transcript | K03A1.8 | |||||||
K03A1.4a.1 | ||||||||
K03A1.4b.1 | ||||||||
K03A1.9 | ||||||||
K03A1.5.1 | ||||||||
T10A3.1d.1 | ||||||||
T10A3.1b.1 | ||||||||
T10A3.5 | ||||||||
T10A3.1a.1 | ||||||||
K03A1.2b.1 | ||||||||
T10A3.2 | ||||||||
T10A3.1f.1 | ||||||||
T10A3.1c.1 | ||||||||
K03A1.2a.1 | ||||||||
T10A3.1e.1 | ||||||||
K03A1.10 | ||||||||
K03A1.2c.1 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Remark | [T10A3]9327/9328-[K03A1]24925/24926 (23545 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target T10A3 updated based on the VEP analysis pipeline to K03A1. | ||||||||
Method | NBP_knockout_allele |