WormBase Tree Display for Variation: WBVar00142941
expand all nodes | collapse all nodes | view schema
WBVar00142941 | Evidence | Paper_evidence | WBPaper00027361 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e61 | |||||||
Other_name | e61sd | ||||||||
F27C1.8.1:c.607G>T | |||||||||
CE09720:p.Gly203Ter | |||||||||
HGVSg | CHROMOSOME_I:g.5432445C>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F27C1 | |||||
Flanking_sequences | ccaggacttgctggaccaccaggacgcgat | gacttaccggaaagggacaaccaggagtcg | |||||||
Mapping_target | F27C1 | ||||||||
Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00027361 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00000065 | ||||||||
WBStrain00000418 | |||||||||
WBStrain00000471 | |||||||||
WBStrain00000478 | |||||||||
WBStrain00003970 | |||||||||
WBStrain00003975 | |||||||||
WBStrain00004089 | |||||||||
WBStrain00004368 | |||||||||
WBStrain00004373 | |||||||||
WBStrain00004383 | |||||||||
WBStrain00004390 | |||||||||
WBStrain00004485 | |||||||||
WBStrain00004633 | |||||||||
WBStrain00004957 | |||||||||
WBStrain00004983 | |||||||||
WBStrain00005015 | |||||||||
WBStrain00005021 | |||||||||
WBStrain00005501 | |||||||||
WBStrain00005538 | |||||||||
WBStrain00005542 | |||||||||
WBStrain00005543 | |||||||||
WBStrain00006182 | |||||||||
WBStrain00006183 | |||||||||
WBStrain00006203 | |||||||||
WBStrain00006216 | |||||||||
WBStrain00006219 | |||||||||
WBStrain00006226 | |||||||||
WBStrain00006233 | |||||||||
WBStrain00006247 | |||||||||
WBStrain00006258 | |||||||||
WBStrain00006261 | |||||||||
WBStrain00006262 | |||||||||
WBStrain00006263 | |||||||||
WBStrain00006264 | |||||||||
WBStrain00006413 | |||||||||
WBStrain00006665 | |||||||||
WBStrain00007169 | |||||||||
WBStrain00007264 | |||||||||
WBStrain00007277 | |||||||||
WBStrain00007331 | |||||||||
WBStrain00007580 | |||||||||
WBStrain00007734 | |||||||||
WBStrain00007737 | |||||||||
WBStrain00007738 | |||||||||
WBStrain00007985 | |||||||||
WBStrain00007986 | |||||||||
WBStrain00007987 | |||||||||
WBStrain00008014 | |||||||||
WBStrain00008021 | |||||||||
WBStrain00008442 | |||||||||
WBStrain00008460 | |||||||||
WBStrain00022478 | |||||||||
WBStrain00022479 | |||||||||
WBStrain00022499 | |||||||||
WBStrain00022537 | |||||||||
WBStrain00022541 | |||||||||
WBStrain00022553 | |||||||||
WBStrain00022558 | |||||||||
WBStrain00022568 | |||||||||
WBStrain00022569 | |||||||||
WBStrain00022576 | |||||||||
WBStrain00022582 | |||||||||
WBStrain00022586 | |||||||||
WBStrain00022592 | |||||||||
WBStrain00022676 | |||||||||
WBStrain00023657 | |||||||||
WBStrain00023658 | |||||||||
WBStrain00023659 | |||||||||
WBStrain00023660 | |||||||||
WBStrain00023661 | |||||||||
WBStrain00023662 | |||||||||
WBStrain00023663 | |||||||||
WBStrain00023664 | |||||||||
WBStrain00023666 | |||||||||
WBStrain00023667 | |||||||||
WBStrain00023668 | |||||||||
WBStrain00023669 | |||||||||
WBStrain00023670 | |||||||||
WBStrain00023671 | |||||||||
WBStrain00023672 | |||||||||
WBStrain00023673 | |||||||||
WBStrain00023674 | |||||||||
WBStrain00023675 | |||||||||
WBStrain00023676 | |||||||||
WBStrain00023677 | |||||||||
WBStrain00023678 | |||||||||
WBStrain00023679 | |||||||||
WBStrain00023680 | |||||||||
WBStrain00023682 | |||||||||
WBStrain00023683 | |||||||||
WBStrain00023685 | |||||||||
WBStrain00023686 | |||||||||
WBStrain00023687 | |||||||||
WBStrain00023688 | |||||||||
WBStrain00023689 | |||||||||
WBStrain00023690 | |||||||||
WBStrain00023691 | |||||||||
WBStrain00023692 | |||||||||
WBStrain00023693 | |||||||||
WBStrain00023694 | |||||||||
WBStrain00023695 | |||||||||
WBStrain00023696 | |||||||||
WBStrain00023697 | |||||||||
WBStrain00023698 | |||||||||
WBStrain00023699 | |||||||||
WBStrain00023700 | |||||||||
WBStrain00023702 | |||||||||
WBStrain00023703 | |||||||||
WBStrain00023705 | |||||||||
WBStrain00023706 | |||||||||
WBStrain00023707 | |||||||||
WBStrain00023708 | |||||||||
WBStrain00023711 | |||||||||
WBStrain00023712 | |||||||||
WBStrain00023713 | |||||||||
WBStrain00023714 | |||||||||
WBStrain00023715 | |||||||||
WBStrain00023717 | |||||||||
WBStrain00023718 | |||||||||
WBStrain00023720 | |||||||||
WBStrain00023722 | |||||||||
WBStrain00023723 | |||||||||
WBStrain00023724 | |||||||||
WBStrain00023725 | |||||||||
WBStrain00023726 | |||||||||
WBStrain00023727 | |||||||||
WBStrain00023728 | |||||||||
WBStrain00023729 | |||||||||
WBStrain00023730 | |||||||||
WBStrain00023732 | |||||||||
WBStrain00023734 | |||||||||
WBStrain00023736 | |||||||||
WBStrain00023737 | |||||||||
WBStrain00023739 | |||||||||
WBStrain00023740 | |||||||||
WBStrain00023741 | |||||||||
WBStrain00023742 | |||||||||
WBStrain00023743 | |||||||||
WBStrain00023744 | |||||||||
WBStrain00023745 | |||||||||
WBStrain00023746 | |||||||||
WBStrain00023747 | |||||||||
WBStrain00023748 | |||||||||
WBStrain00023749 | |||||||||
WBStrain00023750 | |||||||||
WBStrain00023751 | |||||||||
WBStrain00023752 | |||||||||
WBStrain00023753 | |||||||||
WBStrain00023754 | |||||||||
WBStrain00023755 | |||||||||
WBStrain00023756 | |||||||||
WBStrain00023757 | |||||||||
WBStrain00023758 | |||||||||
WBStrain00023759 | |||||||||
WBStrain00023760 | |||||||||
WBStrain00023761 | |||||||||
WBStrain00023762 | |||||||||
WBStrain00023763 | |||||||||
WBStrain00023764 | |||||||||
WBStrain00023765 | |||||||||
WBStrain00023766 | |||||||||
WBStrain00023767 | |||||||||
WBStrain00023768 | |||||||||
WBStrain00023769 | |||||||||
WBStrain00023770 | |||||||||
WBStrain00023774 | |||||||||
WBStrain00023777 | |||||||||
WBStrain00023779 | |||||||||
WBStrain00023780 | |||||||||
WBStrain00023784 | |||||||||
WBStrain00023787 | |||||||||
WBStrain00023788 | |||||||||
WBStrain00023789 | |||||||||
WBStrain00023790 | |||||||||
WBStrain00023791 | |||||||||
WBStrain00023792 | |||||||||
WBStrain00023794 | |||||||||
WBStrain00023798 | |||||||||
WBStrain00023799 | |||||||||
WBStrain00023800 | |||||||||
WBStrain00023801 | |||||||||
WBStrain00023802 | |||||||||
WBStrain00023803 | |||||||||
WBStrain00023805 | |||||||||
WBStrain00023807 | |||||||||
WBStrain00023808 | |||||||||
WBStrain00023809 | |||||||||
WBStrain00023810 | |||||||||
WBStrain00023811 | |||||||||
WBStrain00023812 | |||||||||
WBStrain00023814 | |||||||||
WBStrain00023815 | |||||||||
WBStrain00023816 | |||||||||
WBStrain00023817 | |||||||||
WBStrain00023818 | |||||||||
WBStrain00023819 | |||||||||
WBStrain00023821 | |||||||||
WBStrain00023824 | |||||||||
WBStrain00023825 | |||||||||
WBStrain00023826 | |||||||||
WBStrain00023827 | |||||||||
WBStrain00023828 | |||||||||
WBStrain00023829 | |||||||||
WBStrain00023830 | |||||||||
WBStrain00023831 | |||||||||
WBStrain00023832 | |||||||||
WBStrain00023833 | |||||||||
WBStrain00023834 | |||||||||
WBStrain00023835 | |||||||||
WBStrain00023836 | |||||||||
WBStrain00023839 | |||||||||
WBStrain00023840 | |||||||||
WBStrain00023841 | |||||||||
WBStrain00023842 | |||||||||
WBStrain00023843 | |||||||||
WBStrain00023844 | |||||||||
WBStrain00023845 | |||||||||
WBStrain00023846 | |||||||||
WBStrain00023847 | |||||||||
WBStrain00023849 | |||||||||
WBStrain00023850 | |||||||||
WBStrain00023851 | |||||||||
WBStrain00023852 | |||||||||
WBStrain00023853 | |||||||||
WBStrain00023854 | |||||||||
WBStrain00023855 | |||||||||
WBStrain00023856 | |||||||||
WBStrain00023857 | |||||||||
WBStrain00023858 | |||||||||
WBStrain00023859 | |||||||||
WBStrain00023860 | |||||||||
WBStrain00023861 | |||||||||
WBStrain00023862 | |||||||||
WBStrain00023863 | |||||||||
WBStrain00023864 | |||||||||
WBStrain00023865 | |||||||||
WBStrain00023869 | |||||||||
WBStrain00023870 | |||||||||
WBStrain00023871 | |||||||||
WBStrain00023872 | |||||||||
WBStrain00023873 | |||||||||
WBStrain00023874 | |||||||||
WBStrain00023876 | |||||||||
WBStrain00023878 | |||||||||
WBStrain00023879 | |||||||||
WBStrain00023880 | |||||||||
WBStrain00023881 | |||||||||
WBStrain00023884 | |||||||||
WBStrain00023885 | |||||||||
WBStrain00023886 | |||||||||
WBStrain00023887 | |||||||||
WBStrain00023891 | |||||||||
WBStrain00023892 | |||||||||
WBStrain00023893 | |||||||||
WBStrain00023894 | |||||||||
WBStrain00023895 | |||||||||
WBStrain00023897 | |||||||||
WBStrain00023899 | |||||||||
WBStrain00023900 | |||||||||
WBStrain00023901 | |||||||||
WBStrain00023903 | |||||||||
WBStrain00023904 | |||||||||
WBStrain00023905 | |||||||||
WBStrain00023906 | |||||||||
WBStrain00023907 | |||||||||
WBStrain00023908 | |||||||||
WBStrain00023909 | |||||||||
WBStrain00023910 | |||||||||
WBStrain00023911 | |||||||||
WBStrain00023912 | |||||||||
WBStrain00023913 | |||||||||
WBStrain00023914 | |||||||||
WBStrain00023915 | |||||||||
WBStrain00023916 | |||||||||
WBStrain00023917 | |||||||||
WBStrain00023918 | |||||||||
WBStrain00023919 | |||||||||
WBStrain00023920 | |||||||||
WBStrain00023921 | |||||||||
WBStrain00023922 | |||||||||
WBStrain00023923 | |||||||||
WBStrain00023933 | |||||||||
WBStrain00023934 | |||||||||
WBStrain00023935 | |||||||||
WBStrain00023937 | |||||||||
WBStrain00023938 | |||||||||
WBStrain00023939 | |||||||||
WBStrain00023940 | |||||||||
WBStrain00023943 | |||||||||
WBStrain00023944 | |||||||||
WBStrain00023945 | |||||||||
WBStrain00023946 | |||||||||
WBStrain00023947 | |||||||||
WBStrain00023949 | |||||||||
WBStrain00023965 | |||||||||
WBStrain00023977 | |||||||||
WBStrain00026620 | |||||||||
WBStrain00026735 | |||||||||
WBStrain00026847 | |||||||||
WBStrain00026920 | |||||||||
WBStrain00027045 | |||||||||
WBStrain00027088 | |||||||||
WBStrain00027263 | |||||||||
WBStrain00027269 | |||||||||
WBStrain00027279 | |||||||||
WBStrain00027334 | |||||||||
WBStrain00027345 | |||||||||
WBStrain00027389 | |||||||||
WBStrain00028755 | |||||||||
WBStrain00030675 | |||||||||
WBStrain00033500 | |||||||||
WBStrain00033517 | |||||||||
WBStrain00033905 | |||||||||
WBStrain00034126 | |||||||||
WBStrain00034439 | |||||||||
WBStrain00034653 | |||||||||
WBStrain00040032 | |||||||||
WBStrain00040214 | |||||||||
WBStrain00040443 | |||||||||
WBStrain00040929 | |||||||||
WBStrain00040930 | |||||||||
WBStrain00040931 | |||||||||
WBStrain00049794 | |||||||||
WBStrain00054788 | |||||||||
WBStrain00055739 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Genetics | Interpolated_map_position | I | -0.0011509 | ||||||
Mapping_data | In_2_point (165) | ||||||||
In_multi_point (349) | |||||||||
In_pos_neg_data (72) | |||||||||
Description | Phenotype | WBPhenotype:0000072 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Scanning electron micrograph (SEM) analysis of this strain revealed that dpy-5 mutant nematodes have a relatively normal head morphology; however, the mid-body and tail regions were markedly shorter and fatter than their wild-type counterparts (Fig. 3A)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00061220 | |||||||
Curator_confirmed | WBPerson3900 | ||||||||
Remark | Enhanced susceptibility to levamisole (Figure 3K) | Paper_evidence | WBPaper00061220 | ||||||
Curator_confirmed | WBPerson3900 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00061220 | |||||
Curator_confirmed | WBPerson3900 | ||||||||
WBPhenotype:0000424 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "This ability of a mutation in one collagen to affect others was further confirmed for the non-stage-specific collagen DPY-7, after costaining of the TP14:dpy-5(e61)I;kaIs12(col-19::gfp) strain with the DPY-7 monoclonal antibodies (Fig. 3C, red). In the dorsal/ventral hypodermal cells, DPY-7 localized in a regular but constricted pattern that corresponded to the annular furrows (Fig. 3C, denoted an) and was similar to the COL-19::GFP patterns observed in wild-type and in dpy-5 mutants. Conversely, in the matrix overlying the lateral seam cell cords, DPY-7 expression was abnormal: the DPY-7 staining pattern appeared broken (Fig. 3C, denoted by double-headed arrow) and generally deviated from the wildtype staining pattern in which both annuli (COL-19) and annular furrows (DPY-7) normally extend to appose the lateral ala (Fig. 1C)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000031 | |||||||
WBPaper00005747 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
WBPerson2987 | |||||||||
Remark (2) | |||||||||
Semi_dominant | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In some areas corresponding to the seam cell cords, large vesicles are evident and the tagged protein is found concentrated at the periphery of these structures (Fig. 3D), perhaps indicating a failure in the complete secretion of COL-19::GFP." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000948 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "By using a hypodermal junction-specific monoclonal antibody, MH27 (Francis and Waterston, 1985), we were able to confirm that the hypodermal seam cells were relatively normal in dpy-5(e61) mutant nematodes, whereas the overlying cuticle was abnormal (supplementary Fig. II, F, available online at www.interscience.wiley.com/developmentaldynamics/suppmat/index.html)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "When the strain TP14:dpy-5(e61) I;kaIs12(col-19::gfp), resulting from crossing TP12:kaIs(col-19::gfp) with the dpy-5(e61) mutant, was examined under epifluorescence, the ala, apparent by means of Nomarski imaging (Fig. 3E), were shown to express COL-19::GFP in a variable manner (Fig. 3B, arrowed). In addition, two distinct regions became apparent: a region overlying the dorsal/ventral hypodermal cells, which showed annuli fluorescing as distinct bands as observed in wildtype TP12:kaIs(col-19::gfp) worms (Fig. 3B-D, denoted an), and a second, extended region of disruption overlying the seam cell cords (Fig. 3B-D, double-headed arrows)... The region of dominant COL-19::GFP mutant expression and disruption overlying the lateral seam cell hypodermis has a complex fibrous and broken appearance (Fig. 3B-D, double-headed arrows)... These data show that mutation of the DPY-5 collagen in these nematodes is sufficient to alter the expression patterns of the COL-19::GFP collagen." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors report "multiple or discontinuous ala" (Table 1); "The region of dominant COL-19::GFP mutant expression and disruption overlying the lateral seam cell hypodermis has a complex fibrous and broken appearance (Fig. 3B-D, double-headed arrows)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors report "abnormal branched annuli (lateral hypodermis)" (Table 1); "The disrupted region did not have the characteristic annuli and instead appeared featureless when viewed by Nomarski microscopy (Fig. 3E, double-headed arrow). The regular annular fluorescence did appear more closely packed than in wildtype nematodes (Fig. 3B-D, denoted an), having a periodicity of approximately 0.75 μm compared with 1.2 μm, respectively, an observation consistent with the shorter length of these adult nematodes." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001621 | Paper_evidence | WBPaper00053771 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Hypersensitive to the reactive small molecule and prooxidant juglone. | Paper_evidence | WBPaper00053771 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_not_observed | WBPhenotype:0000071 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Scanning electron micrograph (SEM) analysis of this strain revealed that dpy-5 mutant nematodes have a relatively normal head morphology; however, the mid-body and tail regions were markedly shorter and fatter than their wild-type counterparts (Fig. 3A)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000901 | Paper_evidence | WBPaper00040002 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mutation has no effect on gland morphology | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001732 | Paper_evidence | WBPaper00032033 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited the same pH survival profile as the wild-type strain over a range of pH 3 to pH 10. | Paper_evidence | WBPaper00032033 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Mixed or synchronised populations of nematodes were exposed to 500ul M9 buffer (100 mM phosphate, 85 mM NaCl, 1 mM MgSO4 buffered at the appropriate pH by varying KH2PO4 and Na2HPO4 concentrations accordingly) at varying pHs in a 24-well plate format for 4 h (200 nematodes/well). Nematodes were scored as viable by the presence of touch response and pharyngeal pumping. | Paper_evidence | WBPaper00032033 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002176 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "By using a hypodermal junction-specific monoclonal antibody, MH27 (Francis and Waterston, 1985), we were able to confirm that the hypodermal seam cells were relatively normal in dpy-5(e61) mutant nematodes, whereas the overlying cuticle was abnormal (supplementary Fig. II, F, available online at www.interscience.wiley.com/developmentaldynamics/suppmat/index.html)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (45) | |||||||||
Remark (2) | |||||||||
Method | Substitution_allele |