WormBase Tree Display for Variation: WBVar00090633
expand all nodes | collapse all nodes | view schema
WBVar00090633 | Evidence | Paper_evidence | WBPaper00028753 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n2990 | |||||||
Other_name | JC8.6b.1:c.737G>A | ||||||||
JC8.6c.1:c.746G>A | |||||||||
JC8.6d.1:c.746G>A | |||||||||
CE17990:p.Gly246Glu | |||||||||
CE53077:p.Gly249Glu | |||||||||
JC8.6a.1:c.755G>A | |||||||||
CE17989:p.Gly252Glu | |||||||||
CE53011:p.Gly249Glu | |||||||||
HGVSg | CHROMOSOME_IV:g.13242011G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | JC8 | |||||
Flanking_sequences | ttaccgacatcgaacgtcttcatcagaaag | atgtcactgtaaaaagagtggttgtctgaa | |||||||
Mapping_target | JC8 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00028753 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Linked_to | WBVar01473673 | ||||||||
Affects | Gene | WBGene00003037 | |||||||
Transcript | JC8.6d.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious | |||||||
PolyPhen | 1 | probably_damaging | |||||||
HGVSc | JC8.6d.1:c.746G>A | ||||||||
HGVSp | CE53011:p.Gly249Glu | ||||||||
cDNA_position | 769 | ||||||||
CDS_position | 746 | ||||||||
Protein_position | 249 | ||||||||
Exon_number | 6/9 | ||||||||
Codon_change | gGa/gAa | ||||||||
Amino_acid_change | G/E | ||||||||
JC8.6b.1 (12) | |||||||||
JC8.6c.1 (12) | |||||||||
JC8.6a.1 (12) | |||||||||
Interactor | WBInteraction000052300 | ||||||||
Genetics | Interpolated_map_position | IV | 8.48402 | ||||||
Description | Phenotype | WBPhenotype:0000504 | Paper_evidence | WBPaper00038427 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "lin-54 mutants also exhibit inappropriately connected gut nuclei (right), which may result from defects in mitotic chromosome segregation." (Figure S3A) | Paper_evidence | WBPaper00038427 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005772 | PATO:0000460 | Paper_evidence | WBPaper00038427 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000668 | Paper_evidence | WBPaper00038427 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure S3A | Paper_evidence | WBPaper00038427 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00038427 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table S2, embryo microarray: "We identified 678 genes whose transcripts increased at least 1.5-fold in mutant embryos (Figure 4A, Table S2)... Fewer genes showed reduced expression in mutant embryos (299, Figure 4A)." | Paper_evidence | WBPaper00038427 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00038427 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "To identify genes regulated by LIN-54 in vivo, we performed microarray expression profiling analysis of wild-type and lin-54 mutant C. elegans embryos and of isolated germlines. We chose embryos because they consist primarily of somatic cells, at a developmental stage with both active cell divisions and dynamic developmental gene expression programs." | Paper_evidence | WBPaper00038427 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001372 | Paper_evidence | WBPaper00038427 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark (2) | |||||||||
Phenotype_not_observed | WBPhenotype:0000112 | Paper_evidence | WBPaper00038427 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Control experiments showed that wild-type and lin- 54(n2990) mutant animals produce a comparable amount of fulllength, nuclear-localized LIN-54 protein (Figure 2A and 2B), unlike lin-54(n3423) null animals which produce no detectable LIN-54 protein and reduced amounts of other DRM subunits (Figure 2B and [4])." | Paper_evidence | WBPaper00038427 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00038427 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Control experiments showed that wild-type and lin- 54(n2990) mutant animals produce a comparable amount of fulllength, nuclear-localized LIN-54 protein (Figure 2A and 2B), unlike lin-54(n3423) null animals which produce no detectable LIN-54 protein and reduced amounts of other DRM subunits (Figure 2B and [4])." | Paper_evidence | WBPaper00038427 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (2) | |||||||||
Remark | Allele incorrected cited as n2290 in a couple of places | Paper_evidence | WBPaper00038427 | ||||||
Method | Substitution_allele |