WormBase Tree Display for Variation: WBVar00090633
expand all nodes | collapse all nodes | view schema
WBVar00090633 | Evidence | Paper_evidence | WBPaper00028753 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | n2990 | |||||
Other_name | JC8.6b.1:c.737G>A | ||||||
JC8.6c.1:c.746G>A | |||||||
JC8.6d.1:c.746G>A | |||||||
CE17990:p.Gly246Glu | |||||||
CE53077:p.Gly249Glu | |||||||
JC8.6a.1:c.755G>A | |||||||
CE17989:p.Gly252Glu | |||||||
CE53011:p.Gly249Glu | |||||||
HGVSg | CHROMOSOME_IV:g.13242011G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | JC8 | |||
Flanking_sequences | ttaccgacatcgaacgtcttcatcagaaag | atgtcactgtaaaaagagtggttgtctgaa | |||||
Mapping_target | JC8 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00028753 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | MT | ||||||
Status | Live | ||||||
Linked_to | WBVar01473673 | ||||||
Affects | Gene | WBGene00003037 | |||||
Transcript | JC8.6d.1 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | ||||||
SIFT | 0 | deleterious | |||||
PolyPhen | 1 | probably_damaging | |||||
HGVSc | JC8.6d.1:c.746G>A | ||||||
HGVSp | CE53011:p.Gly249Glu | ||||||
cDNA_position | 769 | ||||||
CDS_position | 746 | ||||||
Protein_position | 249 | ||||||
Exon_number | 6/9 | ||||||
Codon_change | gGa/gAa | ||||||
Amino_acid_change | G/E | ||||||
JC8.6b.1 (12) | |||||||
JC8.6c.1 (12) | |||||||
JC8.6a.1 (12) | |||||||
Interactor | WBInteraction000052300 | ||||||
Genetics | Interpolated_map_position | IV | 8.48402 | ||||
Description | Phenotype (4) | ||||||
Phenotype_not_observed | WBPhenotype:0000112 | Paper_evidence | WBPaper00038427 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | "Control experiments showed that wild-type and lin- 54(n2990) mutant animals produce a comparable amount of fulllength, nuclear-localized LIN-54 protein (Figure 2A and 2B), unlike lin-54(n3423) null animals which produce no detectable LIN-54 protein and reduced amounts of other DRM subunits (Figure 2B and [4])." | Paper_evidence | WBPaper00038427 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00038427 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | "Control experiments showed that wild-type and lin- 54(n2990) mutant animals produce a comparable amount of fulllength, nuclear-localized LIN-54 protein (Figure 2A and 2B), unlike lin-54(n3423) null animals which produce no detectable LIN-54 protein and reduced amounts of other DRM subunits (Figure 2B and [4])." | Paper_evidence | WBPaper00038427 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Reference | WBPaper00038427 | ||||||
WBPaper00005861 | |||||||
Remark | Allele incorrected cited as n2290 in a couple of places | Paper_evidence | WBPaper00038427 | ||||
Method | Substitution_allele |