WormBase Tree Display for Variation: WBVar00143102
expand all nodes | collapse all nodes | view schema
WBVar00143102 | Evidence | Paper_evidence | WBPaper00002911 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e307 | |||||||
Other_name | T20G5.6.1:c.1280-1G>A | ||||||||
HGVSg | CHROMOSOME_III:g.10184104C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | T20G5 | |||||
Flanking_sequences | ggatttttctgccgcaaatttatgtttcca | gaacaatgttatcatttatctggccggcact | |||||||
Mapping_target | T20G5 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002911 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00006783 | |||||||
Transcript | T20G5.6.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T20G5.6.1:c.1280-1G>A | ||||||||
Intron_number | 5/7 | ||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | III | 2.00018 | ||||||
Mapping_data | In_2_point | 55 | |||||||
62 | |||||||||
67 | |||||||||
74 | |||||||||
3248 | |||||||||
In_multi_point | 59 | ||||||||
61 | |||||||||
69 | |||||||||
72 | |||||||||
91 | |||||||||
1244 | |||||||||
1245 | |||||||||
1253 | |||||||||
1509 | |||||||||
1668 | |||||||||
2191 | |||||||||
2193 | |||||||||
2195 | |||||||||
2200 | |||||||||
2201 | |||||||||
2202 | |||||||||
3171 | |||||||||
3172 | |||||||||
3173 | |||||||||
3174 | |||||||||
3176 | |||||||||
3260 | |||||||||
In_pos_neg_data | 651 | ||||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | % animals paralyzed after 60 min on 1mM aldicarb was significantly higher than % N2 animals paralyzed. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Paper_evidence | WBPaper00031872 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000153 | Paper_evidence | WBPaper00032190 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed strong shortening upon photoactivation of ChR2-YFP. | Paper_evidence | WBPaper00032190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | ChR2-YFP was activated in animals swimming in liquid, or on solid substrates, by applying 450-490 nm light. The chromophore essential fro ChR2 function was supplied by growing transgenic animals on medium containing all-trans retinal. | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | zxIs6 | Paper_evidence | WBPaper00032190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000229 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000402 | Paper_evidence | WBPaper00056338 | |||||||
Curator_confirmed | WBPerson36360 | ||||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | % animals paralyzed after 60 min on 200mM levamisole was significantly higher than % N2 animals paralyzed under same conditions. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000426 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal staining with anti-GABA antibodies (accumulates GABA) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000563 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slight shrinker (contracts both dorsally and ventrally when prodded) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slow forward movement | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000655 | Paper_evidence | WBPaper00002911 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001005 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | very poor backing | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001316 | Paper_evidence | WBPaper00032190 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Light-evoked currents (photo-ePSCs) were abolished. | Paper_evidence | WBPaper00032190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | ChR2-YFP was activated in animals swimming in liquid, or on solid substrates, by applying 450-490 nm light. The chromophore essential fro ChR2 function was supplied by growing transgenic animals on medium containing all-trans retinal. | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | zxIs6 | Paper_evidence | WBPaper00032190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001802 | Paper_evidence | WBPaper00032190 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not elongate upon illumination (photoactivation of ChR2-YFP in GABAergic neurons), unlike wild-type animals carrying the zxIs3. | Paper_evidence | WBPaper00032190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Photo-evoked relaxation was severely impaired. | Paper_evidence | WBPaper00032190 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | ChR2-YFP was activated in animals swimming in liquid, or on solid substrates, by applying 450-490 nm light. The chromophore essential fro ChR2 function was supplied by growing transgenic animals on medium containing all-trans retinal. | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | zxIs3 | Paper_evidence | WBPaper00032190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002159 | Paper_evidence | WBPaper00056338 | |||||||
Curator_confirmed | WBPerson36360 | ||||||||
WBPhenotype:0004018 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | good forward movement | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00032190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Expression of ChR2-YFP in GABAergic neurons was not affected. | Paper_evidence | WBPaper00032190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | zxIs3 | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000567 | Paper_evidence | WBPaper00032190 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Dorsal coiling was not triggered in animals treated to photostimulation of ChR2-YFP in cholinergic neurons. | Paper_evidence | WBPaper00032190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | ChR2-YFP was activated in animals swimming in liquid, or on solid substrates, by applying 450-490 nm light. The chromophore essential fro ChR2 function was supplied by growing transgenic animals on medium containing all-trans retinal. | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | zxIs6 | Paper_evidence | WBPaper00032190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00002911 | ||||||||
WBPaper00040284 | |||||||||
WBPaper00031872 | |||||||||
WBPaper00000031 | |||||||||
WBPaper00032190 | |||||||||
WBPaper00016473 | |||||||||
WBPaper00056338 | |||||||||
Method | Substitution_allele |