WormBase Tree Display for Variation: WBVar00275548
expand all nodes | collapse all nodes | view schema
WBVar00275548 | Evidence | Paper_evidence | WBPaper00005198 | ||||||
---|---|---|---|---|---|---|---|---|---|
WBPaper00026975 | |||||||||
Name | Public_name | zu405 | |||||||
Other_name | C09G9.6.1:c.719C>T | ||||||||
CE03005:p.Pro240Leu | |||||||||
HGVSg | CHROMOSOME_IV:g.8889984C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C27B7 | |||||
Flanking_sequences | ctttagaaatgtttgccaggccatcaactc | agatgagccagcggctaaattgccactagg | |||||||
Mapping_target | C27B7 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00026975 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00035066 | ||||||||
WBStrain00035067 | |||||||||
WBStrain00035068 | |||||||||
WBStrain00048324 | |||||||||
WBStrain00052677 | |||||||||
Laboratory | JJ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003864 | |||||||
Transcript | C09G9.6.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious | |||||||
PolyPhen | 0.996 | probably_damaging | |||||||
HGVSc | C09G9.6.1:c.719C>T | ||||||||
HGVSp | CE03005:p.Pro240Leu | ||||||||
cDNA_position | 829 | ||||||||
CDS_position | 719 | ||||||||
Protein_position | 240 | ||||||||
Exon_number | 6/8 | ||||||||
Codon_change | cCa/cTa | ||||||||
Amino_acid_change | P/L | ||||||||
Interactor | WBInteraction000051359 | ||||||||
WBInteraction000501903 | |||||||||
WBInteraction000501904 | |||||||||
WBInteraction000501905 | |||||||||
WBInteraction000501906 | |||||||||
WBInteraction000501907 | |||||||||
WBInteraction000501908 | |||||||||
WBInteraction000501909 | |||||||||
WBInteraction000501910 | |||||||||
WBInteraction000524794 | |||||||||
Genetics | Interpolated_map_position | IV | 3.99916 | ||||||
Mapping_data | In_2_point | 7138 | |||||||
Description | Phenotype (13) | ||||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No ectopic expression of fkh-6::GFP was observed. | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00005930 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Spatial localization of OMA-1 resembles wild-type. OMA-1 protein colocalizes with P-granules in the germline precursors in zu405 mutant embryos | Paper_evidence | WBPaper00005930 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00005930 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00005930 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005930 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00005930 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00005930 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Costaining with various antibodies known to recognize P-granules, such as OIC4, MEX-1 antibody, and POS-1 antibody | Paper_evidence | WBPaper00005930 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001021 | Paper_evidence | WBPaper00036019 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutant males are not feminized based on fkh-6::GFP expression. | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001357 | Paper_evidence | WBPaper00036019 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No defects in male gonad morphology was observed. | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00036019 | ||||||||
WBPaper00018617 | |||||||||
WBPaper00026975 | |||||||||
WBPaper00010630 | |||||||||
WBPaper00005930 | |||||||||
WBPaper00027952 | |||||||||
WBPaper00018887 | |||||||||
WBPaper00026378 | |||||||||
WBPaper00046178 | |||||||||
WBPaper00048539 | |||||||||
WBPaper00061828 | |||||||||
Method | Substitution_allele |