WormBase Tree Display for RNAi: WBRNAi00079052
expand all nodes | collapse all nodes | view schema
WBRNAi00079052 | Homol | Homol_homol | T24D3:RNAi | |||
---|---|---|---|---|---|---|
K04C2:RNAi | ||||||
Y49E10:RNAi | ||||||
ZK507:RNAi | ||||||
CHROMOSOME_III:RNAi | ||||||
Sequence_info | DNA_text | atggcctacccttaccccgttttcaatgctgaaaatgtctttgacaatacccagcaacaagttggattctatgattattcaactccattcaatggtacatactcctttactactgactattcttattataataactactatgactatgtcaatacttatgcttcttattatccaactgcaatggattcttcatctttaaatatttcatcaactactggaagtcctaattcttcacatttcaccacgtttactcatttttccactccatctacatctccatctacctctactcaaagttcaactacaccgagcaattctgataataagaagtcatttcaatgctcaaattgttcagtaactgaaacaattcgttggaggaatattcgatcaaaggaaggaattcaatgtaatgcttgtttcatttatcaacggaaatataataagactcgtccagtcactgccgttaacaaatatcaaaaaagaaaattaaaggtacaggaaacgaatggtgtagattcattttaa | ||||
PCR_product | sjj_F02A9.6 | |||||
sjj_Y49E10.14 | ||||||
Experiment | Laboratory | JR | ||||
Date | 25 Jan 2001 00:00:00 | |||||
Delivered_by | Injection | |||||
Inhibits | Predicted_gene (5) | |||||
Gene | WBGene00003180 | Inferred_automatically | RNAi_primary | |||
WBGene00003181 | Inferred_automatically | RNAi_primary | ||||
WBGene00001609 | Inferred_automatically | RNAi_primary | ||||
WBGene00004027 | Inferred_automatically | RNAi_primary | ||||
Transcript | Y49E10.14a.1 | Inferred_automatically | RNAi_primary | |||
F02A9.6.1 | Inferred_automatically | RNAi_primary | ||||
T24D3.1.1 | Inferred_automatically | RNAi_primary | ||||
Y49E10.14b.1 | Inferred_automatically | RNAi_primary | ||||
K04C2.6.1 | Inferred_automatically | RNAi_primary | ||||
Species | Caenorhabditis elegans | |||||
Interaction | WBInteraction000050898 | |||||
Reference | WBPaper00004636 | |||||
Phenotype | WBPhenotype:0001375 | Remark | Loss of ceh-22::GFP expression (pharyngeal marker) | |||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
WBPhenotype:0001637 | Penetrance | Incomplete | ||||
Range | 41 | |||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
WBPhenotype:0001646 | Remark | Synthetic phenotype: glp-1(RNAi)/pie-1(RNAi) double RNAi and med-1/2 RNAi do not give this phenotype. glp-1(RNAi)/pie(RNAi)/med-1/2(RNAi) results in the no_pharynx phenotype | ||||
Penetrance | Incomplete | |||||
Range | 60 | |||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
Remark | Exact sequence used for glp-1 and pie-1 RNAi not stated by authors, Ahringer laboratory clone used for curation. Exact sequence used for med-1/2 RNAi not stated by authors, spliced coding region sequence of med-1 gene used for curation. | |||||
Method | RNAi |