WormBase Tree Display for Feature: WBsf978986
expand all nodes | collapse all nodes | view schema
WBsf978986 | SMap | S_parent | Sequence | T05G5 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | cggagatattgaagattcaggagctgacat | agcaacagaggaacactttgatctaaaaaa | |
Mapping_target | T05G5 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible (2) | ||||
Defined_by | Defined_by_paper | WBPaper00042525 | ||
Associations | Associated_with_gene | WBGene00011503 | ||
Associated_with_Interaction (41) | ||||
Remark | [150922 gw3] This is a region upstream of gcc-2 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
[180209 gw3] The original assignment of this region in the paper was to ech-6. This is clearly wrong and has been changed in the other comments in this object to be the correct gene 'gcc-2'. | Curator_confirmed | WBPerson4025 | ||
Method | promoter |