WormBase Tree Display for Feature: WBsf978961
expand all nodes | collapse all nodes | view schema
| WBsf978961 | SMap | S_parent | Sequence | F46C8 |
|---|---|---|---|---|
| Name | Public_name | PAG-3 binding motif | ||
| Sequence_details | Flanking_sequences | aaagttttttggaaagatgctattgctccg | gaggaacgagcggatttgagaggatttctg | |
| Mapping_target | F46C8 | |||
| DNA_text | aaaatcac | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Binding site for PAG-3 transcription factor within the promoter region of ceh-14 | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00046959 | ||
| Associations | Associated_with_gene | WBGene00000438 | ||
| Associated_with_Interaction | WBInteraction000532899 | |||
| Associated_with_transcription_factor | WBTranscriptionFactor000513 | |||
| Bound_by_product_of | WBGene00003090 | |||
| Method | TF_binding_site |
