WormBase Tree Display for Feature: WBsf977374
expand all nodes | collapse all nodes | view schema
WBsf977374 | SMap | S_parent | Sequence | Y75B12B | |
---|---|---|---|---|---|
Name | Public_name | GLD-1 binding site | |||
Sequence_details | Flanking_sequences | ttgttctccgtgagaacttttcttcttttc | ccatccaaccctgtttattgcttcactttt | ||
Mapping_target | Y75B12B | ||||
DNA_text | CAATCAC | ||||
Origin | Species | Caenorhabditis elegans | |||
Visible | Description | GLD-1 binding site on mRNA transcript of this gene. | |||
SO_term | SO:0000409 | ||||
Defined_by | Defined_by_paper | WBPaper00040521 | Curator_confirmed | WBPerson4025 | |
Associations | Associated_with_gene | WBGene00000883 | |||
Bound_by_product_of | WBGene00001595 | ||||
Remark | Added this GLD-1 binding site as a 'binding_site'. It might be better to change this in future to 'translation_regulatory_region' or 'nucleotide_to_protein_binding_site'. | Curator_confirmed | WBPerson4025 | ||
Method | binding_site |