WormBase Tree Display for Feature: WBsf919560
expand all nodes | collapse all nodes | view schema
WBsf919560 | SMap | S_parent | Sequence | Y46H3A |
---|---|---|---|---|
Name | Public_name | HSE1 | ||
Sequence_details | Flanking_sequences | tccttatatacccgcattctgcagccttacagaatg | ggtcctagatgcattcgtttgaaaatactccc | |
Mapping_target | Y46H3A | |||
DNA_text | TTCTAGAA | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | This is the conserved binding site region 'HSE1' for hsp-16.2 and hsp-16.41 | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00005280 | ||
Associations | Associated_with_gene | WBGene00002016 | ||
WBGene00002018 | ||||
Associated_with_transcription_factor | WBTranscriptionFactor000178 | |||
Bound_by_product_of | WBGene00002004 | |||
Remark | This is the conserved binding site region 'HSE1' for hsp-16.2 and hsp-16.41. [2013-07-23 gw3] | |||
Method | TF_binding_site |