WormBase Tree Display for Feature: WBsf034246
expand all nodes | collapse all nodes | view schema
| WBsf034246 | SMap | S_parent | Sequence | R03C1 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | ttcccatagttatagccatttttttttctt | ttctcttcaaattggattctaatgacataa | |
| Mapping_target | R03C1 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | cog-1 3'UTR | ||
| SO_term | SO:0000409 | |||
| Defined_by | Defined_by_paper | WBPaper00031864 | ||
| Associations | Associated_with_gene | WBGene00000584 | ||
| Bound_by_product_of | WBGene00003095 | |||
| Remark | Base pairs 258-350 of the cog-1 3'UTR alone are sufficient for regulation of lys-6 | Paper_evidence | WBPaper00031864 | |
| Method | binding_site_region |
