WormBase Tree Display for Feature: WBsf019177
expand all nodes | collapse all nodes | view schema
| WBsf019177 | SMap | S_parent | Sequence | C12C8 |
|---|---|---|---|---|
| Name | Public_name | LCS 1 | ||
| Sequence_details (2) | ||||
| DNA_text | UUAUACAACCGUUCUACACUCA | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible (2) | ||||
| Defined_by | Defined_by_paper (3) | |||
| Associations (2) | ||||
| Bound_by_product_of | WBGene00002285 | |||
| Remark | This is the miRNA let-7 complementary sequence 1 (LCS 1) which shows conservation compared to C. briggsae. [2014-09-02 gw3] | |||
| Method | binding_site |
