Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7246

expand all nodes | collapse all nodes | view schema

Name Class

Expr7246Expression_of (2)
HomolHomol_homolZK688:Expr
Expression_data (2)
TypeReporter_gene[gly-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCTCAGTTTTCCACTTTTCTCT] 3' and primer B 5' [TGATTAAAAATTCAGGGGAAAAA] 3'.
PatternLarval Expression: intestine; rectal gland cells; Reproductive System; developing vulva; hypodermis; seam cells;
RemarkStrain: BC14831
ReferenceWBPaper00006525
TransgeneWBTransgene00003732