WormBase Tree Display for Expr_pattern: Expr7077
expand all nodes | collapse all nodes | view schema
Expr7077 | Expression_of | Gene | WBGene00013308 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00013308 | ||||
Homol | Homol_homol | Y57G11C:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005738 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005813 | |||||
WBbt:0006760 | |||||
Type | Reporter_gene | [Y57G11C.12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTTCAAGAAATACAGTACCCCAC] 3' and primer B 5' [CGAAAGAGTATCTCCTTTGGTGA] 3'. | |||
Pattern | Adult Expression: pharynx; Reproductive System; uterus; body wall muscle; | ||||
Larval Expression: pharynx; Reproductive System; developing uterus; body wall muscle; unidentified cells in body ; | |||||
Picture | WBPicture0000006937 | ||||
WBPicture0000006938 | |||||
Remark | Also expressed in (comments from author) : unidentified tissue in the body is part of the reproductive system | ||||
Strain: BC14533 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00003592 |