WormBase Tree Display for Expr_pattern: Expr6363
expand all nodes | collapse all nodes | view schema
Expr6363 | Expression_of | Gene | WBGene00000875 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00000875 | ||||
Homol | Homol_homol | K08E3:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005300 | |||||
WBbt:0005733 | |||||
WBbt:0005735 | |||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005753 | |||||
WBbt:0005772 | |||||
WBbt:0006751 | |||||
Type | Reporter_gene | [cyk-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCGATAAATTGGACGGTATATT] 3' and primer B 5' [CTGGACTTGATTCTAAAATGTGGA] 3'. | |||
Pattern | Adult Expression: intestine; | ||||
Larval Expression: pharynx; intestine; hypodermis; seam cells; Nervous System; ventral nerve cord; head neurons; unidentified cells; unidentified cells in tail ; | |||||
Remark | Also expressed in (comments from author) : GFP expression in adults was much less than in the larvae. | ||||
Strain: BC10601 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002328 |