WormBase Tree Display for Expr_pattern: Expr6260

Expr6260 Expression_of: Gene: WBGene00003822
    Reflects_endogenous_expression_of: WBGene00003822
  Homol: Homol_homol: F59A6:Expr
  Expression_data: Life_stage: WBls:0000041
    Anatomy_term: WBbt:0005733
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005741 Partial
        Remark: unidentified cells
      WBbt:0005772
  Type: Reporter_gene: [nsy-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCCTCACCGACAGTTTAAG] 3' and primer B 5' [CTGCGAGATTTTCTTTTGATTCTT] 3'.
  Pattern: Adult Expression: intestine; hypodermis; unidentified cells in head; unidentified cells in tail ;
  Picture: WBPicture0000005639
    WBPicture0000005640
    WBPicture0000005641
  Remark: Also expressed in (comments from author) : Notes were not entered into database, and images are only for adult. Have extrapolated data from the images, but this leaves the analysis incomplete. Unidentified head/tail GFP may be neural.
    Strain: BC10545
  Reference: WBPaper00006525
  Transgene: WBTransgene00002304