WormBase Tree Display for Expr_pattern: Expr6117
expand all nodes | collapse all nodes | view schema
Expr6117 | Expression_of | Gene | WBGene00000105 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00000105 | ||
Homol | Homol_homol | K02B9:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [alg-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTGTCACCGCGTAGTCTT] 3' and primer B 5' [GTCGTTTGAGGCGACGTTAG] 3'. | |
Pattern | Adult Expression: pharynx; Reproductive System; uterus; vulva other; spermatheca uterine valve; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: pharynx; Reproductive System; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail ; | |||
Picture | WBPicture0000005375 | ||
WBPicture0000005376 | |||
WBPicture0000005377 | |||
WBPicture0000005378 | |||
WBPicture0000005379 | |||
Remark | Also expressed in (comments from author) : unidentified cells in head and tail, some probably neural, also maybe head mesodermal cell.Mosaic population. | ||
Strain: BC12839 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002986 |